KEGG   Azotobacter chroococcum: Achr_20120
Entry
Achr_20120        tRNA      T03640                                 
Name
(GenBank) tRNA-Cys
  KO
K14222  tRNA Cys
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_20120
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_20120
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_20120
SSDB
LinkDB
Position
2241713..2241783
NT seq 71 nt   +upstreamnt  +downstreamnt
ggccgggtggcagagtggtcatgcagcggattgcaaatccgtgtacgccggttcgattcc
gacctcggcct

DBGET integrated database retrieval system