KEGG   Azotobacter chroococcum: Achr_20130
Entry
Achr_20130        tRNA      T03640                                 
Name
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_20130
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_20130
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_20130
SSDB
LinkDB
Position
2241942..2242025
NT seq 84 nt   +upstreamnt  +downstreamnt
gcccggatggcgaaattggtagacgcaagggacttaaaatccctcgctggcaacagcgtg
ccggttcgatcccggctccgggca

KEGG   Azotobacter chroococcum: Achr_22980
Entry
Achr_22980        tRNA      T03640                                 
Name
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_22980
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_22980
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_22980
SSDB
LinkDB
Position
complement(2562050..2562131)
NT seq 82 nt   +upstreamnt  +downstreamnt
gcggatgtggtggaattggtagacacactggatttaggttccagcgccgcaaggcgtaag
agttcgagtctcttcatccgca

KEGG   Azotobacter chroococcum: Achr_33580
Entry
Achr_33580        tRNA      T03640                                 
Name
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_33580
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_33580
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_33580
SSDB
LinkDB
Position
3761262..3761345
NT seq 84 nt   +upstreamnt  +downstreamnt
gcccaggtggcggaattggtagacgcactaggttcaggtcctagcggtggcaacaccgtg
gaagttcgagtcttctcctgggca

KEGG   Azotobacter chroococcum: Achr_33590
Entry
Achr_33590        tRNA      T03640                                 
Name
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_33590
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_33590
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_33590
SSDB
LinkDB
Position
3761458..3761541
NT seq 84 nt   +upstreamnt  +downstreamnt
gcccaggtggcggaattggtagacgcactaggttcaggtcctagcggtggcaacaccgtg
gaagttcgagtcttctcctgggca

KEGG   Azotobacter chroococcum: Achr_7790
Entry
Achr_7790         tRNA      T03640                                 
Name
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_7790
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_7790
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_7790
SSDB
LinkDB
Position
870169..870251
NT seq 83 nt   +upstreamnt  +downstreamnt
gccgaggtggtggaattggtagacacgctaccttgaggtggtagtggccataggctgtag
gggttcgagtcccctcctcggta

KEGG   Azotobacter chroococcum: Achr_9930
Entry
Achr_9930         tRNA      T03640                                 
Name
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_9930
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_9930
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_9930
SSDB
LinkDB
Position
complement(1100444..1100527)
NT seq 84 nt   +upstreamnt  +downstreamnt
gcctcggtggcggaatcggtagacgcggcggattcaaaatccgtttctggcgacagagtg
agagttcgagtctctcccggggca

DBGET integrated database retrieval system