KEGG   Azotobacter chroococcum: Achr_22990
Entry
Achr_22990        tRNA      T03640                                 
Name
(GenBank) tRNA-His
  KO
K14226  tRNA His
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_22990
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_22990
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_22990
SSDB
LinkDB
Position
complement(2562194..2562266)
NT seq 73 nt   +upstreamnt  +downstreamnt
gtgggcgtagctcagttggtagagcacaggattgtggctcctggtgtcgtgggttcgatt
cccatcgtccacc

DBGET integrated database retrieval system