KEGG   Azotobacter chroococcum: Achr_25460
Entry
Achr_25460        tRNA      T03640                                 
Name
(GenBank) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_25460
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_25460
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_25460
SSDB
LinkDB
Position
complement(2858776..2858848)
NT seq 73 nt   +upstreamnt  +downstreamnt
gtccccttcgtctagtggcctaggacaccgccctttcacggcggtaacaggggttcgagt
cccctaggggacg

KEGG   Azotobacter chroococcum: Achr_25480
Entry
Achr_25480        tRNA      T03640                                 
Name
(GenBank) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_25480
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_25480
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_25480
SSDB
LinkDB
Position
complement(2859027..2859099)
NT seq 73 nt   +upstreamnt  +downstreamnt
gtccccttcgtctagtggcctaggacaccgccctttcacggcggtaacaggggttcgagt
cccctaggggacg

KEGG   Azotobacter chroococcum: Achr_27310
Entry
Achr_27310        tRNA      T03640                                 
Name
(GenBank) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_27310
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_27310
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_27310
SSDB
LinkDB
Position
complement(3088560..3088632)
NT seq 73 nt   +upstreamnt  +downstreamnt
gtccccttcgtctagtggcctaggacaccgccctttcacggcggtaacaggggttcgagt
cccctaggggacg

DBGET integrated database retrieval system