KEGG   Azotobacter chroococcum: Achr_26160
Entry
Achr_26160        tRNA      T03640                                 
Name
(GenBank) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_26160
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_26160
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_26160
SSDB
LinkDB
Position
complement(2938278..2938350)
NT seq 73 nt   +upstreamnt  +downstreamnt
gccggtgtagctcagtcggtagagcggctcattcgtaatgagaaggtcgagggttcgatt
cctttcaccggca

KEGG   Azotobacter chroococcum: Achr_35260
Entry
Achr_35260        tRNA      T03640                                 
Name
(GenBank) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_35260
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_35260
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_35260
SSDB
LinkDB
Position
complement(3914482..3914554)
NT seq 73 nt   +upstreamnt  +downstreamnt
gctcatgtagctcagctggtagagcacacccttggtaagggtgaggtcagcggttcaaat
ccgctcatgagct

KEGG   Azotobacter chroococcum: Achr_37530
Entry
Achr_37530        tRNA      T03640                                 
Name
(GenBank) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_37530
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_37530
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_37530
SSDB
LinkDB
Position
4169748..4169820
NT seq 73 nt   +upstreamnt  +downstreamnt
gccggtatagctcagcaggtagagcaactgacttgtaatcagtaggtcccgggttcgatt
cctggtgccggca

DBGET integrated database retrieval system