KEGG   Azotobacter chroococcum: Achr_36545
Entry
Achr_36545        tRNA      T03640                                 
Name
(GenBank) tRNA-Phe
  KO
K14231  tRNA Phe
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_36545
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_36545
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_36545
SSDB
LinkDB
Position
4066298..4066370
NT seq 73 nt   +upstreamnt  +downstreamnt
gcccaggtagctcagtcggtagagcaggggattgaaaatccccgtgtcggcggttcgatt
ccgtccctgggca

KEGG   Azotobacter chroococcum: Achr_36550
Entry
Achr_36550        tRNA      T03640                                 
Name
(GenBank) tRNA-Phe
  KO
K14231  tRNA Phe
Organism
acx  Azotobacter chroococcum
Pathway
acx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Achr_36550
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acx03100]
    Achr_36550
Non-coding RNAs [BR:acx03100]
 Transfer RNA
  Achr_36550
SSDB
LinkDB
Position
4066414..4066486
NT seq 73 nt   +upstreamnt  +downstreamnt
gcccaggtagctcagtcggtagagcaggggattgaaaatccccgtgtcggcggttcgatt
ccgtccctgggca

DBGET integrated database retrieval system