Alloalcanivorax dieselolei: B5T_00283 Help Entry B5T_00283         CDS       T02259                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism adi  Alloalcanivorax dieselolei Brite KEGG Orthology (KO) [BR:adi00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:adi03036]     B5T_00283 Chromosome and associated proteins [BR:adi03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     B5T_00283 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB NRBF2 EMP24_GP25L YabA DivIC Motif Other DBs NCBI-ProteinID:  AFT68570 UniProt:  K0C7T4 LinkDB All DBs Position complement(302122..302337) Genome browser AA seq 71 aa AA seqDB search MTTEQQLRQLEAQVDSLLRQSNRLREENRLLREREHRLLDERARLIRKNDLARSRVEAII TRLQSLEQEDS NT seq 216 nt NT seq  +upstreamnt  +downstreamnt atgacgacggaacaacaactgcggcaactggaagcccaggtggactccctgctgcgtcag tccaaccgtttgcgcgaagagaatcgtctgctgcgcgagcgggaacaccgtcttctcgat gaacgggcccggctcatccgtaaaaacgacttggcccgctcccgggtggaggcgatcata acgcgcctgcaatccctggagcaggaggactcatga

DBGET integrated database retrieval system