Aeromonas schubertii: WL1483_940 Help Entry WL1483_940        CDS       T04186                                  Symbol hfq Name (GenBank) RNA-binding protein Hfq   KO K03666   host factor-I protein Organism asr  Aeromonas schubertii Pathway asr02024   Quorum sensing asr03018   RNA degradation Brite KEGG Orthology (KO) [BR:asr00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03018 RNA degradation     WL1483_940 (hfq)  09140 Cellular Processes   09145 Cellular community - prokaryotes    02024 Quorum sensing     WL1483_940 (hfq)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:asr03019]     WL1483_940 (hfq)    03036 Chromosome and associated proteins [BR:asr03036]     WL1483_940 (hfq) Messenger RNA biogenesis [BR:asr03019]  Prokaryotic type   Bacterial mRNA degradation factors    Other RNA degradation factors     Chaperones      WL1483_940 (hfq) Chromosome and associated proteins [BR:asr03036]  Prokaryotic type   Nucleoid associated proteins    Other nucleoid associated proteins     WL1483_940 (hfq) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Hfq LSM Hfq_1 Motif Other DBs NCBI-ProteinID:  ALP40359 UniProt:  A0A0S2SF95 LinkDB All DBs Position complement(3867941..3868177) Genome browser AA seq 78 aa AA seqDB search MNALRRERIPVSIYLVNGIKLQGQIESFDQFVILLKNTVSQMVYKHAISTVVPARAVNHH QHAAQGGQSDEQQGESEA NT seq 237 nt NT seq  +upstreamnt  +downstreamnt ttgaatgcgctgcgccgtgagcgtattccggtttctatctatttggtgaacggcatcaaa ctgcaaggtcaaatcgagtccttcgaccagttcgttatcctgctcaagaacaccgtcagc cagatggtctacaagcatgccatctccaccgtggtgccggctcgcgccgttaaccatcat cagcatgctgcccagggcggtcagtccgacgagcagcagggtgagagtgaagcctga

DBGET integrated database retrieval system