Edwardsiella hoshinae: A9798_02250 Help Entry A9798_02250       CDS       T04508                                  Name (GenBank) YbgT family membrane protein   KO K22501   cytochrome bd-II ubiquinol oxidase subunit AppX [EC:7.1.1.7] Organism eho  Edwardsiella hoshinae Pathway eho00190   Oxidative phosphorylation eho01100   Metabolic pathways eho02020   Two-component system Module eho_M00153   Cytochrome bd ubiquinol oxidase Brite KEGG Orthology (KO) [BR:eho00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     A9798_02250  09130 Environmental Information Processing   09132 Signal transduction    02020 Two-component system     A9798_02250 Enzymes [BR:eho01000]  7. Translocases   7.1  Catalysing the translocation of protons    7.1.1  Linked to oxidoreductase reactions     7.1.1.7  quinol oxidase (electrogenic, proton-motive force generating)      A9798_02250 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  YbgT_YccB Motif Other DBs NCBI-ProteinID:  AOV95888 UniProt:  A0A376D835 LinkDB All DBs Position 508385..508474 Genome browser AA seq 29 aa AA seqDB search MWYLVWFVGILLMCTLSTLVLVWLEPRLK NT seq 90 nt NT seq  +upstreamnt  +downstreamnt atgtggtatttagtgtggtttgtcggcatcttgctgatgtgtacgctgtcgacgctggtg ttggtgtggcttgagccacgcctgaaataa

DBGET integrated database retrieval system