Edwardsiella tarda: ETAF_2721 Help Entry ETAF_2721         CDS       T02091                                  Name (GenBank) hypothetical protein   KO K22501   cytochrome bd-II ubiquinol oxidase subunit AppX [EC:7.1.1.7] Organism etd  Edwardsiella tarda Pathway etd00190   Oxidative phosphorylation etd01100   Metabolic pathways etd02020   Two-component system Module etd_M00153   Cytochrome bd ubiquinol oxidase Brite KEGG Orthology (KO) [BR:etd00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     ETAF_2721  09130 Environmental Information Processing   09132 Signal transduction    02020 Two-component system     ETAF_2721 Enzymes [BR:etd01000]  7. Translocases   7.1  Catalysing the translocation of protons    7.1.1  Linked to oxidoreductase reactions     7.1.1.7  quinol oxidase (electrogenic, proton-motive force generating)      ETAF_2721 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  YbgT_YccB Adeno_E3B Motif Other DBs NCBI-ProteinID:  ADM42824 UniProt:  A0A0H3DWA6 LinkDB All DBs Position complement(3101656..3101745) Genome browser AA seq 29 aa AA seqDB search MWYLLWFVGILLMCSLSTLILVWLEPRLK NT seq 90 nt NT seq  +upstreamnt  +downstreamnt atgtggtatttactgtggtttgtcggcattttgctgatgtgttcgctgtctaccctgatc ctggtatggcttgagccgcggctgaaatag

DBGET integrated database retrieval system