Hirundo rustica (Barn swallow): 120757847 Help Entry 120757847         CDS       T09369                                  Name (RefSeq) C-C motif chemokine 3-like   KO K05408   C-C motif chemokine 3 Organism hrt  Hirundo rustica (Barn swallow) Pathway hrt04060   Cytokine-cytokine receptor interaction hrt04620   Toll-like receptor signaling pathway Brite KEGG Orthology (KO) [BR:hrt00001]  09130 Environmental Information Processing   09133 Signaling molecules and interaction    04060 Cytokine-cytokine receptor interaction     120757847  09150 Organismal Systems   09151 Immune system    04620 Toll-like receptor signaling pathway     120757847  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04052 Cytokines and neuropeptides [BR:hrt04052]     120757847    00536 Glycosaminoglycan binding proteins [BR:hrt00536]     120757847 Cytokines and neuropeptides [BR:hrt04052]  Cytokines   Chemokines    120757847 Glycosaminoglycan binding proteins [BR:hrt00536]  Heparan sulfate / Heparin   Chemokines    120757847 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  IL8 Motif Other DBs NCBI-GeneID:  120757847 NCBI-ProteinID:  XP_039931434 LinkDB All DBs Position 11:complement(6778026..6779513) Genome browser AA seq 87 aa AA seqDB search MLPARTVLLLTLLLTFSLHHATAHFPPVECCFKYAQKRIRHPQSYYETSKDCPNPAVVIV AASGEEICADPKKDWVDKIIKRLERKK NT seq 264 nt NT seq  +upstreamnt  +downstreamnt atgctccctgcaaggactgtcctgctgctcaccctgctcctcaccttctccctgcaccac gccacagcccactttccacccgtggaatgctgctttaagtacgcacagaaacgcatccga catcctcagagctactacgagacatccaaagactgccccaaccctgcagttgtgatcgtg gcagccagtggtgaagagatttgtgccgaccccaagaaggactgggtggataaaatcata aaacggctcgaaaggaaaaaataa

DBGET integrated database retrieval system