KEGG   Homo sapiens (human): 101954264
Entry
101954264         ncRNA     T01001                                 
Symbol
RNVU1-4, RNU1-102, RNU1-50, RNVU1-5, vU1.4, vU1.5
Name
(RefSeq) RNA, variant U1 small nuclear 4
  KO
K14276  U1 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    101954264 (RNVU1-4)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    101954264 (RNVU1-4)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    101954264 (RNVU1-4)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  101954264 (RNVU1-4)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   101954264 (RNVU1-4)
SSDB
Other DBs
NCBI-GeneID: 101954264
HGNC: 48312
Ensembl: ENSG00000277610
LinkDB
Position
1:120942600..120942763
NT seq 164 nt   +upstreamnt  +downstreamnt
atgtttatctggcagaagaaatgttatgatcacgaaggtggtttttccagagcaaggctt
agcagttttactgtggatgtgctgacccctgtgatttccccgaatgtgggaatcttgatt
acataatttgtggcagtggggaactgtgtctgtgtttttccctg

KEGG   Homo sapiens (human): 101954268
Entry
101954268         ncRNA     T01001                                 
Symbol
RNVU1-20, RNU1-110, vU1.20
Name
(RefSeq) RNA, variant U1 small nuclear 20
  KO
K14276  U1 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    101954268 (RNVU1-20)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    101954268 (RNVU1-20)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    101954268 (RNVU1-20)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  101954268 (RNVU1-20)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   101954268 (RNVU1-20)
SSDB
Other DBs
NCBI-GeneID: 101954268
HGNC: 48325
LinkDB
Position
1q21.2
NT seq 163 nt   +upstreamnt  +downstreamnt
atgtttatctggcagaagaaatgttatgatcacgaaggtggtttttccagagcaaggctt
agcagttttactgtggatgtgctgacccctgtgatttccccgaatgtgggaatcttgatt
acataatttgtggcagtggggaactgtgtctgtgttttcccct

KEGG   Homo sapiens (human): 101954273
Entry
101954273         ncRNA     T01001                                 
Symbol
RNVU1-1, RNU1-10P, RNU1-53, RNU1P10, RNVU1-10, U1.4, U1P14, vU1.1, vU1.10
Name
(RefSeq) RNA, variant U1 small nuclear 1
  KO
K14276  U1 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    101954273 (RNVU1-1)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    101954273 (RNVU1-1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    101954273 (RNVU1-1)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  101954273 (RNVU1-1)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   101954273 (RNVU1-1)
SSDB
Other DBs
NCBI-GeneID: 101954273
HGNC: 10133
Ensembl: ENSG00000207340
LinkDB
Position
1:complement(148362370..148362533)
NT seq 164 nt   +upstreamnt  +downstreamnt
atacttacctggcaggggagatacgatgatcacgaaggtggttttcccagggagaggctt
atccattgcactccggatgtgctgacccctgccgtttccccaaatgtgggaaactcgact
gcataatttgtggtagtgggggactgcgttcgcgctgtcctctg

KEGG   Homo sapiens (human): 26863
Entry
26863             ncRNA     T01001                                 
Symbol
RNVU1-18, RNU1-25, RNU1-25P, RNU1-5, RNU1P1, RNU1P9, U1.15, U1P101, U1P15, vU1.18
Name
(RefSeq) RNA, variant U1 small nuclear 18
  KO
K14276  U1 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    26863 (RNVU1-18)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    26863 (RNVU1-18)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    26863 (RNVU1-18)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  26863 (RNVU1-18)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   26863 (RNVU1-18)
SSDB
Other DBs
NCBI-GeneID: 26863
HGNC: 37496
Ensembl: ENSG00000206737
LinkDB
Position
1:complement(143729407..143729570)
NT seq 164 nt   +upstreamnt  +downstreamnt
atacttacctggcaggggagataccatgatcacgaaggtggttttcccagggcgaggctt
atccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgact
gcataatttgtggtagtgggggactgcgttcgcgctttcccctg

KEGG   Homo sapiens (human): 26864
Entry
26864             ncRNA     T01001                                 
Symbol
RNVU1-7, RNU1-26P, RNU1-6, RNU1-6P, RNU1-9, RNU1-9P, RNVU1-9, vU1.7, vU1.9
Name
(RefSeq) RNA, variant U1 small nuclear 7
  KO
K14276  U1 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    26864 (RNVU1-7)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    26864 (RNVU1-7)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    26864 (RNVU1-7)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  26864 (RNVU1-7)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   26864 (RNVU1-7)
SSDB
Other DBs
NCBI-GeneID: 26864
HGNC: 37500
Ensembl: ENSG00000206585
LinkDB
Position
1:complement(148038753..148038916)
NT seq 164 nt   +upstreamnt  +downstreamnt
atacttacctggcaggggagataccatgatcacgaaggtggttttcccagggcgaggctt
atccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgact
gcataatttgtggtagtgggggactgcgtccgcgctttcccctg

KEGG   Homo sapiens (human): 26869
Entry
26869             ncRNA     T01001                                 
Symbol
RNU1-3, HSD4, RNU1G3
Name
(RefSeq) RNA, U1 small nuclear 3
  KO
K14276  U1 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    26869 (RNU1-3)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    26869 (RNU1-3)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    26869 (RNU1-3)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  26869 (RNU1-3)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   26869 (RNU1-3)
SSDB
Other DBs
NCBI-GeneID: 26869
HGNC: 10130
Ensembl: ENSG00000207513
LinkDB
Position
1:complement(16666785..16666948)
NT seq 164 nt   +upstreamnt  +downstreamnt
atacttacctggcaggggagataccatgatcacgaaggtggttttcccagggcgaggctt
atccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgact
gcataatttgtggtagtgggggactgcgttcgcgctttcccctg

KEGG   Homo sapiens (human): 26870
Entry
26870             ncRNA     T01001                                 
Symbol
RNU1-2, RNU1C1, RNU1C2, U1C1, U1C21
Name
(RefSeq) RNA, U1 small nuclear 2
  KO
K14276  U1 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    26870 (RNU1-2)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    26870 (RNU1-2)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    26870 (RNU1-2)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  26870 (RNU1-2)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   26870 (RNU1-2)
SSDB
Other DBs
NCBI-GeneID: 26870
HGNC: 10123
Ensembl: ENSG00000207005
LinkDB
Position
1:16895980..16896143
NT seq 164 nt   +upstreamnt  +downstreamnt
atacttacctggcaggggagataccatgatcacgaaggtggttttcccagggcgaggctt
atccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgact
gcataatttgtggtagtgggggactgcgttcgcgctttcccctg

KEGG   Homo sapiens (human): 26871
Entry
26871             ncRNA     T01001                                 
Symbol
RNU1-1, HSD1, HU1-1, RNU1, RNU1A, RNU1A3, RNU1G4, Rnu1a1, U1, U1A1
Name
(RefSeq) RNA, U1 small nuclear 1
  KO
K14276  U1 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    26871 (RNU1-1)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    26871 (RNU1-1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    26871 (RNU1-1)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  26871 (RNU1-1)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   26871 (RNU1-1)
SSDB
Other DBs
NCBI-GeneID: 26871
HGNC: 10120
Ensembl: ENSG00000206652
LinkDB
Position
1:complement(16514122..16514285)
NT seq 164 nt   +upstreamnt  +downstreamnt
atacttacctggcaggggagataccatgatcacgaaggtggttttcccagggcgaggctt
atccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgact
gcataatttgtggtagtgggggactgcgttcgcgctttcccctg

KEGG   Homo sapiens (human): 6060
Entry
6060              ncRNA     T01001                                 
Symbol
RNU1-4, HSD2, HSD5, HSD6, HSD7, RNU1, RNU1D2, RNU1E2, RNU1F1, RNU1G1, RNU1G2, U1B2, U1D2, U1E2, U1F
Name
(RefSeq) RNA, U1 small nuclear 4
  KO
K14276  U1 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    6060 (RNU1-4)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    6060 (RNU1-4)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    6060 (RNU1-4)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  6060 (RNU1-4)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   6060 (RNU1-4)
SSDB
Other DBs
NCBI-GeneID: 6060
OMIM: 180680
HGNC: 10128
Ensembl: ENSG00000207389
LinkDB
Position
1:16740516..16740679
NT seq 164 nt   +upstreamnt  +downstreamnt
atacttacctggcaggggagataccatgatcacgaaggtggttttcccagggcgaggctt
atccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgact
gcataatttgtggtagtgggggactgcgttcgcgctttcccctg

DBGET integrated database retrieval system