KEGG   Homo sapiens (human): 101954271
Entry
101954271         ncRNA     T01001                                 
Symbol
RNU6-9, U6-9
Name
(RefSeq) RNA, U6 small nuclear 9
  KO
K14280  U6 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    101954271 (RNU6-9)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    101954271 (RNU6-9)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    101954271 (RNU6-9)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  101954271 (RNU6-9)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   101954271 (RNU6-9)
SSDB
Other DBs
NCBI-GeneID: 101954271
HGNC: 34269
Ensembl: ENSG00000207507
LinkDB
Position
19:893484..893590
NT seq 107 nt   +upstreamnt  +downstreamnt
gtgctcgcttcggcagcacatatactaaaattggaacgatacagagaagattagcatggc
ccctgcgcaaggatgacacgcaaattcgtgaagcgttccatattttt

KEGG   Homo sapiens (human): 26827
Entry
26827             ncRNA     T01001                                 
Symbol
RNU6-1, RNU6, RNU6A, U6, U6-1
Name
(RefSeq) RNA, U6 small nuclear 1
  KO
K14280  U6 spliceosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    26827 (RNU6-1)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:hsa03041]
    26827 (RNU6-1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    26827 (RNU6-1)
Spliceosome [BR:hsa03041]
 Spliceosomal RNAs
  26827 (RNU6-1)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nuclear RNA
   26827 (RNU6-1)
SSDB
Other DBs
NCBI-GeneID: 26827
OMIM: 180692
HGNC: 10227
Ensembl: ENSG00000206625
LinkDB
Position
15:complement(67839940..67840045)
NT seq 106 nt   +upstreamnt  +downstreamnt
gtgctcgcttcggcagcacatatactaaaattggaacgatacagagaagattagcatggc
ccctgcgcaaggatgacacgcaaattcgtgaagcgttccatatttt

DBGET integrated database retrieval system