KEGG   Homo sapiens (human): 406881
Entry
406881            miRNA     T01001                                 
Symbol
MIRLET7A1, LET7A1, MIRNLET7A1, let-7a-1
Name
(RefSeq) microRNA let-7a-1
  KO
K16980  microRNA let-7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
hsa05207  Chemical carcinogenesis - receptor activation
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406881 (MIRLET7A1)
   05207 Chemical carcinogenesis - receptor activation
    406881 (MIRLET7A1)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406881 (MIRLET7A1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406881 (MIRLET7A1)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406881 (MIRLET7A1)
  Exosomal RNA of saliva
   406881 (MIRLET7A1)
  Exosomal RNA of ovarian cancer cells
   406881 (MIRLET7A1)
  Exosomal RNA of renal carcinoma cells
   406881 (MIRLET7A1)
  Exosomal RNA of other cancer cells
   406881 (MIRLET7A1)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406881 (MIRLET7A1)
SSDB
Other DBs
NCBI-GeneID: 406881
OMIM: 605386
HGNC: 31476
Ensembl: ENSG00000199165
miRBase: MI0000060
LinkDB
Position
9:94175957..94176036
NT seq 22 nt   +upstreamnt  +downstreamnt
tgaggtagtaggttgtatagtt

KEGG   Homo sapiens (human): 406882
Entry
406882            miRNA     T01001                                 
Symbol
MIRLET7A2, LET7A2, MIRNLET7A2, let-7a-2
Name
(RefSeq) microRNA let-7a-2
  KO
K16980  microRNA let-7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
hsa05207  Chemical carcinogenesis - receptor activation
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406882 (MIRLET7A2)
   05207 Chemical carcinogenesis - receptor activation
    406882 (MIRLET7A2)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406882 (MIRLET7A2)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406882 (MIRLET7A2)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406882 (MIRLET7A2)
  Exosomal RNA of saliva
   406882 (MIRLET7A2)
  Exosomal RNA of ovarian cancer cells
   406882 (MIRLET7A2)
  Exosomal RNA of renal carcinoma cells
   406882 (MIRLET7A2)
  Exosomal RNA of other cancer cells
   406882 (MIRLET7A2)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406882 (MIRLET7A2)
SSDB
Other DBs
NCBI-GeneID: 406882
OMIM: 612142
HGNC: 31477
Ensembl: ENSG00000198975
miRBase: MI0000061
LinkDB
Position
11:complement(122146522..122146593)
NT seq 22 nt   +upstreamnt  +downstreamnt
tgaggtagtaggttgtatagtt

KEGG   Homo sapiens (human): 406883
Entry
406883            miRNA     T01001                                 
Symbol
MIRLET7A3, LET7A3, MIRNLET7A3, let-7a-3
Name
(RefSeq) microRNA let-7a-3
  KO
K16980  microRNA let-7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
hsa05207  Chemical carcinogenesis - receptor activation
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406883 (MIRLET7A3)
   05207 Chemical carcinogenesis - receptor activation
    406883 (MIRLET7A3)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406883 (MIRLET7A3)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406883 (MIRLET7A3)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406883 (MIRLET7A3)
  Exosomal RNA of saliva
   406883 (MIRLET7A3)
  Exosomal RNA of ovarian cancer cells
   406883 (MIRLET7A3)
  Exosomal RNA of renal carcinoma cells
   406883 (MIRLET7A3)
  Exosomal RNA of other cancer cells
   406883 (MIRLET7A3)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406883 (MIRLET7A3)
SSDB
Other DBs
NCBI-GeneID: 406883
OMIM: 612143
HGNC: 31478
Ensembl: ENSG00000283990
miRBase: MI0000062
LinkDB
Position
22:46112749..46112822
NT seq 22 nt   +upstreamnt  +downstreamnt
tgaggtagtaggttgtatagtt

KEGG   Homo sapiens (human): 406884
Entry
406884            miRNA     T01001                                 
Symbol
MIRLET7B, LET7B, MIRNLET7B, hsa-let-7b, let-7b
Name
(RefSeq) microRNA let-7b
  KO
K16980  microRNA let-7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
hsa05207  Chemical carcinogenesis - receptor activation
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406884 (MIRLET7B)
   05207 Chemical carcinogenesis - receptor activation
    406884 (MIRLET7B)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406884 (MIRLET7B)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406884 (MIRLET7B)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406884 (MIRLET7B)
  Exosomal RNA of saliva
   406884 (MIRLET7B)
  Exosomal RNA of ovarian cancer cells
   406884 (MIRLET7B)
  Exosomal RNA of renal carcinoma cells
   406884 (MIRLET7B)
  Exosomal RNA of other cancer cells
   406884 (MIRLET7B)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406884 (MIRLET7B)
SSDB
Other DBs
NCBI-GeneID: 406884
OMIM: 611249
HGNC: 31479
Ensembl: ENSG00000284520
miRBase: MI0000063
LinkDB
Position
22:46113686..46113768
NT seq 22 nt   +upstreamnt  +downstreamnt
tgaggtagtaggttgtgtggtt

KEGG   Homo sapiens (human): 406886
Entry
406886            miRNA     T01001                                 
Symbol
MIRLET7D, LET7D, MIRNLET7D, hsa-let-7d, let-7d
Name
(RefSeq) microRNA let-7d
  KO
K16980  microRNA let-7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
hsa05207  Chemical carcinogenesis - receptor activation
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406886 (MIRLET7D)
   05207 Chemical carcinogenesis - receptor activation
    406886 (MIRLET7D)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406886 (MIRLET7D)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406886 (MIRLET7D)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406886 (MIRLET7D)
  Exosomal RNA of saliva
   406886 (MIRLET7D)
  Exosomal RNA of ovarian cancer cells
   406886 (MIRLET7D)
  Exosomal RNA of renal carcinoma cells
   406886 (MIRLET7D)
  Exosomal RNA of other cancer cells
   406886 (MIRLET7D)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406886 (MIRLET7D)
SSDB
Other DBs
NCBI-GeneID: 406886
OMIM: 612145
HGNC: 31481
Ensembl: ENSG00000199133
miRBase: MI0000065
LinkDB
Position
9:94178834..94178920
NT seq 22 nt   +upstreamnt  +downstreamnt
agaggtagtaggttgcatagtt

KEGG   Homo sapiens (human): 406887
Entry
406887            miRNA     T01001                                 
Symbol
MIRLET7E, LET7E, MIRNLET7E, hsa-let-7e, let-7e
Name
(RefSeq) microRNA let-7e
  KO
K16980  microRNA let-7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
hsa05207  Chemical carcinogenesis - receptor activation
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406887 (MIRLET7E)
   05207 Chemical carcinogenesis - receptor activation
    406887 (MIRLET7E)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406887 (MIRLET7E)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406887 (MIRLET7E)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406887 (MIRLET7E)
  Exosomal RNA of saliva
   406887 (MIRLET7E)
  Exosomal RNA of ovarian cancer cells
   406887 (MIRLET7E)
  Exosomal RNA of renal carcinoma cells
   406887 (MIRLET7E)
  Exosomal RNA of other cancer cells
   406887 (MIRLET7E)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406887 (MIRLET7E)
SSDB
Other DBs
NCBI-GeneID: 406887
OMIM: 611250
HGNC: 31482
Ensembl: ENSG00000198972
miRBase: MI0000066
LinkDB
Position
19:51692786..51692864
NT seq 22 nt   +upstreamnt  +downstreamnt
tgaggtaggaggttgtatagtt

KEGG   Homo sapiens (human): 406888
Entry
406888            miRNA     T01001                                 
Symbol
MIRLET7F1, LET7F1, MIRNLET7F1, let-7f-1
Name
(RefSeq) microRNA let-7f-1
  KO
K16980  microRNA let-7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
hsa05207  Chemical carcinogenesis - receptor activation
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406888 (MIRLET7F1)
   05207 Chemical carcinogenesis - receptor activation
    406888 (MIRLET7F1)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406888 (MIRLET7F1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406888 (MIRLET7F1)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406888 (MIRLET7F1)
  Exosomal RNA of saliva
   406888 (MIRLET7F1)
  Exosomal RNA of ovarian cancer cells
   406888 (MIRLET7F1)
  Exosomal RNA of renal carcinoma cells
   406888 (MIRLET7F1)
  Exosomal RNA of other cancer cells
   406888 (MIRLET7F1)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406888 (MIRLET7F1)
SSDB
Other DBs
NCBI-GeneID: 406888
OMIM: 612146
HGNC: 31483
Ensembl: ENSG00000199072
miRBase: MI0000067
LinkDB
Position
9:94176347..94176433
NT seq 22 nt   +upstreamnt  +downstreamnt
tgaggtagtagattgtatagtt

KEGG   Homo sapiens (human): 406889
Entry
406889            miRNA     T01001                                 
Symbol
MIRLET7F2, LET7F2, MIRNLET7F2, let-7f-2
Name
(RefSeq) microRNA let-7f-2
  KO
K16980  microRNA let-7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
hsa05207  Chemical carcinogenesis - receptor activation
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406889 (MIRLET7F2)
   05207 Chemical carcinogenesis - receptor activation
    406889 (MIRLET7F2)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406889 (MIRLET7F2)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406889 (MIRLET7F2)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406889 (MIRLET7F2)
  Exosomal RNA of saliva
   406889 (MIRLET7F2)
  Exosomal RNA of ovarian cancer cells
   406889 (MIRLET7F2)
  Exosomal RNA of renal carcinoma cells
   406889 (MIRLET7F2)
  Exosomal RNA of other cancer cells
   406889 (MIRLET7F2)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406889 (MIRLET7F2)
SSDB
Other DBs
NCBI-GeneID: 406889
OMIM: 300721
HGNC: 31484
Ensembl: ENSG00000208012
miRBase: MI0000068
LinkDB
Position
X:complement(53557192..53557274)
NT seq 22 nt   +upstreamnt  +downstreamnt
tgaggtagtagattgtatagtt

KEGG   Homo sapiens (human): 406890
Entry
406890            miRNA     T01001                                 
Symbol
MIRLET7G, LET7G, MIRNLET7G, hsa-let-7g, let-7g
Name
(RefSeq) microRNA let-7g
  KO
K16980  microRNA let-7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
hsa05207  Chemical carcinogenesis - receptor activation
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406890 (MIRLET7G)
   05207 Chemical carcinogenesis - receptor activation
    406890 (MIRLET7G)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406890 (MIRLET7G)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406890 (MIRLET7G)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406890 (MIRLET7G)
  Exosomal RNA of saliva
   406890 (MIRLET7G)
  Exosomal RNA of ovarian cancer cells
   406890 (MIRLET7G)
  Exosomal RNA of renal carcinoma cells
   406890 (MIRLET7G)
  Exosomal RNA of other cancer cells
   406890 (MIRLET7G)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406890 (MIRLET7G)
SSDB
Other DBs
NCBI-GeneID: 406890
OMIM: 612102
HGNC: 31485
Ensembl: ENSG00000199150
miRBase: MI0000433
LinkDB
Position
3:complement(52268278..52268361)
NT seq 22 nt   +upstreamnt  +downstreamnt
tgaggtagtagtttgtacagtt

KEGG   Homo sapiens (human): 406891
Entry
406891            miRNA     T01001                                 
Symbol
MIRLET7I, LET7I, MIRNLET7I, hsa-let-7i, let-7i
Name
(RefSeq) microRNA let-7i
  KO
K16980  microRNA let-7
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
hsa05207  Chemical carcinogenesis - receptor activation
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406891 (MIRLET7I)
   05207 Chemical carcinogenesis - receptor activation
    406891 (MIRLET7I)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406891 (MIRLET7I)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406891 (MIRLET7I)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   406891 (MIRLET7I)
  Exosomal RNA of saliva
   406891 (MIRLET7I)
  Exosomal RNA of ovarian cancer cells
   406891 (MIRLET7I)
  Exosomal RNA of renal carcinoma cells
   406891 (MIRLET7I)
  Exosomal RNA of other cancer cells
   406891 (MIRLET7I)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Micro RNA
   406891 (MIRLET7I)
SSDB
Other DBs
NCBI-GeneID: 406891
OMIM: 612148
HGNC: 31486
Ensembl: ENSG00000199179
miRBase: MI0000434
LinkDB
Position
12:62603686..62603769
NT seq 22 nt   +upstreamnt  +downstreamnt
tgaggtagtagtttgtgctgtt

DBGET integrated database retrieval system