Janthinobacterium sp. LM6: BZG29_14395 Help Entry BZG29_14395       CDS       T04756                                  Name (GenBank) DNA-binding protein HU   KO K03530   DNA-binding protein HU-beta Organism jal  Janthinobacterium sp. LM6 Brite KEGG Orthology (KO) [BR:jal00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:jal03032]     BZG29_14395    03036 Chromosome and associated proteins [BR:jal03036]     BZG29_14395    03400 DNA repair and recombination proteins [BR:jal03400]     BZG29_14395 DNA replication proteins [BR:jal03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     BZG29_14395 Chromosome and associated proteins [BR:jal03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     BZG29_14395 DNA repair and recombination proteins [BR:jal03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       BZG29_14395 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_1 HYPK_UBA Motif Other DBs NCBI-ProteinID:  AQR69397 LinkDB All DBs Position 3278635..3278907 Genome browser AA seq 90 aa AA seqDB search MNKTELIDHIAEKADISKAAAARALDAVIGGVTETLKNNDSVTLVGFGTFSVSERAERTG RNPRTKEAITIEAAKVPKFKAGKALKDAVN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt gtgaacaagactgaattgatcgaccacattgctgaaaaagctgacatttccaaagccgcc gctgcgcgcgcactcgacgctgttatcggcggcgtgacggaaactttgaaaaacaacgac agcgtgacgctggttggttttggcactttctcggtcagcgaacgcgctgagcgtaccggc cgcaatccgcgtaccaaagaagcgatcacgatcgaagcagcaaaagttccaaaatttaaa gctggtaaagctttgaaggatgctgtaaactaa

DBGET integrated database retrieval system