KEGG   Mus musculus (mouse): 387140Help
Entry
387140            miRNA     T01002                                 

Gene name
Mir21a, Mir21, Mirn21, mmu-mir-21, mmu-mir-21a
Definition
(RefSeq) microRNA 21a
  KO
K16863  microRNA 21
Organism
mmu  Mus musculus (mouse)
Pathway
mmu05205  Proteoglycans in cancer
mmu05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:mmu00001]
 09160 Human Diseases
  09161 Cancers: Overview
   05206 MicroRNAs in cancer
    387140 (Mir21a)
   05205 Proteoglycans in cancer
    387140 (Mir21a)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:mmu04147]
    387140 (Mir21a)
  09184 RNA family
   03100 Non-coding RNAs [BR:mmu03100]
    387140 (Mir21a)
Exosome [BR:mmu04147]
 Exosomal RNA
  Exosomal RNA of breast milk
   387140 (Mir21a)
  Exosomal RNA of ovarian cancer cells
   387140 (Mir21a)
  Exosomal RNA of lung cancer cells
   387140 (Mir21a)
  Exosomal RNA of other cancer cells
   387140 (Mir21a)
Non-coding RNAs [BR:mmu03100]
 Micro RNA
  miRNA
   387140 (Mir21a)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 387140
MGI: 2676885
Ensembl: ENSMUSG00000065455
miRBase: MI0000569
LinkDB All DBs
Position
11; 11 C
NT seq 22 nt NT seq  +upstreamnt  +downstreamnt
tagcttatcagactgatgttga

DBGET integrated database retrieval system