Mycobacterium tuberculosis CTRI-2: MTCTRI2_1119 Help Entry MTCTRI2_1119      CDS       T01993                                  Symbol celA2a Name (GenBank) endo-1,4-beta-glucanase   KO K01179   endoglucanase [EC:3.2.1.4] Organism mto  Mycobacterium tuberculosis CTRI-2 Pathway mto00500   Starch and sucrose metabolism mto01100   Metabolic pathways mto02020   Two-component system Brite KEGG Orthology (KO) [BR:mto00001]  09100 Metabolism   09101 Carbohydrate metabolism    00500 Starch and sucrose metabolism     MTCTRI2_1119 (celA2a)  09130 Environmental Information Processing   09132 Signal transduction    02020 Two-component system     MTCTRI2_1119 (celA2a) Enzymes [BR:mto01000]  3. Hydrolases   3.2  Glycosylases    3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds     3.2.1.4  cellulase      MTCTRI2_1119 (celA2a) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-ProteinID:  AEM99548 LinkDB All DBs Position 1215954..1216058 Genome browser AA seq 34 aa AA seqDB search MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY NT seq 105 nt NT seq  +upstreamnt  +downstreamnt atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system