Ornithorhynchus anatinus (platypus): 114813704 Help Entry 114813704         CDS       T01045                                  Name (RefSeq) corticoliberin-like   KO K05256   corticotropin-releasing hormone Organism oaa  Ornithorhynchus anatinus (platypus) Pathway oaa04024   cAMP signaling pathway oaa04080   Neuroactive ligand-receptor interaction oaa04730   Long-term depression oaa04934   Cushing syndrome oaa05034   Alcoholism Brite KEGG Orthology (KO) [BR:oaa00001]  09130 Environmental Information Processing   09132 Signal transduction    04024 cAMP signaling pathway     114813704   09133 Signaling molecules and interaction    04080 Neuroactive ligand-receptor interaction     114813704  09150 Organismal Systems   09156 Nervous system    04730 Long-term depression     114813704  09160 Human Diseases   09165 Substance dependence    05034 Alcoholism     114813704   09167 Endocrine and metabolic disease    04934 Cushing syndrome     114813704  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04052 Cytokines and neuropeptides [BR:oaa04052]     114813704 Cytokines and neuropeptides [BR:oaa04052]  Neuropeptides   Neuropeptides (GPCR binding)    114813704 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CRF Motif Other DBs NCBI-GeneID:  114813704 NCBI-ProteinID:  XP_028926053 Ensembl:  ENSOANG00000046737 LinkDB All DBs Position 8:20327282..20338882 Genome browser AA seq 102 aa AA seqDB search MTMLALAAVSVSVLLLLPPASGSPLTLAWEASPVPVPVPAPSRRGWSDSSSPAGVRAGWG RERRPNALDLSFHLLRELLHRAREEQLARKAHGNRRRLQALG NT seq 309 nt NT seq  +upstreamnt  +downstreamnt atgaccatgttggcgctggcggccgtgagcgtgtccgtcctgctgctcctgcccccggcc tccggctctccgctgaccctcgcctgggaagcctcgccggtcccggttcctgtcccggcc ccgtcccgccgtgggtggagcgactcctcgagtccggcgggtgtcagggcgggctggggg cgggagaggaggcccaacgcgctggacctgtccttccacctgctgcgggagctcctccac cgggcccgggaggagcagctggctcgaaaggcgcacggcaaccgccggaggctccaggcc ctgggctag

DBGET integrated database retrieval system