KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131339
Entry
3131339           tRNA      T01015                                 
Symbol
trnK, OrsajCt121
Name
(RefSeq) tRNA-Lys
  KO
K14229  tRNA Lys
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131339 (trnK)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131339 (trnK)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131339 (trnK)
SSDB
Other DBs
NCBI-GeneID: 3131339
LinkDB
Position
Pltd:complement(1363..3938)
NT seq 72 nt   +upstreamnt  +downstreamnt
tttatctgggttgctaactcaatggtagagtactcggccgggttcgagtcccgggcaacc
catatggaaact

DBGET integrated database retrieval system