KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131340
Entry
3131340           tRNA      T01015                                 
Symbol
OrsajCt122
Name
(RefSeq) tRNA-Gln
  KO
K14223  tRNA Gln
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131340 (OrsajCt122)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131340 (OrsajCt122)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131340 (OrsajCt122)
SSDB
Other DBs
NCBI-GeneID: 3131340
LinkDB
Position
Pltd:complement(6615..6687)
NT seq 73 nt   +upstreamnt  +downstreamnt
tggggcgtggccaagtggtaaggcagcgggttttggtcccgttactcggaggttcgaatc
cttccgtcccaga

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450186
Entry
6450186           tRNA      T01015                                 
Symbol
trnQ, OrsajM_t07
Name
(RefSeq) tRNA-Gln
  KO
K14223  tRNA Gln
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450186 (trnQ)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450186 (trnQ)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450186 (trnQ)
SSDB
Other DBs
NCBI-GeneID: 6450186
LinkDB
Position
MT:complement(45135..45206)
NT seq 72 nt   +upstreamnt  +downstreamnt
tggagtatagccaagtggtaaggcatcggtttttggtaccggcatgcaaaggttcgaatc
cttttactccag

DBGET integrated database retrieval system