KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131341
Entry
3131341           tRNA      T01015                                 
Symbol
OrsajCt123
Name
(RefSeq) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131341 (OrsajCt123)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131341 (OrsajCt123)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131341 (OrsajCt123)
SSDB
Other DBs
NCBI-GeneID: 3131341
LinkDB
Position
Pltd:complement(7829..7916)
NT seq 88 nt   +upstreamnt  +downstreamnt
ggagagatggctgagtggactaaagcggcggattgctaatccgttgtacaatttttttgt
accgagggttcgaatccctctctttccg

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131342
Entry
3131342           tRNA      T01015                                 
Symbol
OrsajCt124
Name
(RefSeq) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131342 (OrsajCt124)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131342 (OrsajCt124)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131342 (OrsajCt124)
SSDB
Other DBs
NCBI-GeneID: 3131342
LinkDB
Position
Pltd:complement(11503..11590)
NT seq 88 nt   +upstreamnt  +downstreamnt
ggagagatggctgagtggttgatagctccggtcttgaaaaccggtatagttctaggaact
atcgagggttcgaatccctctctctcct

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131352
Entry
3131352           tRNA      T01015                                 
Symbol
OrsajCt137
Name
(RefSeq) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131352 (OrsajCt137)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131352 (OrsajCt137)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131352 (OrsajCt137)
SSDB
Other DBs
NCBI-GeneID: 3131352
LinkDB
Position
Pltd:44438..44524
NT seq 87 nt   +upstreamnt  +downstreamnt
ggagagatggccgagcggttcaaggcgtagcattggaactgctatgtagacttttgttta
ccgagggttcgaatccctctctttccg

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450131
Entry
6450131           tRNA      T01015                                 
Symbol
trnS, OrsajM_t15
Name
(RefSeq) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450131 (trnS)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450131 (trnS)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450131 (trnS)
SSDB
Other DBs
NCBI-GeneID: 6450131
LinkDB
Position
MT:261618..261704
NT seq 87 nt   +upstreamnt  +downstreamnt
ggatggatgtctgagcggttgaaagagtcggtcttgaaaaccgaagtattgataggaata
ccgggggttcgaatccctctccatccg

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450153
Entry
6450153           tRNA      T01015                                 
Symbol
trnS, OrsajM_t17
Name
(RefSeq) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450153 (trnS)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450153 (trnS)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450153 (trnS)
SSDB
Other DBs
NCBI-GeneID: 6450153
LinkDB
Position
MT:357852..357938
NT seq 87 nt   +upstreamnt  +downstreamnt
ggagagatggccgagcggttcaaggcgtagcattggaactgctatgtaggcttttgttta
ccgagggttcgaatccctctctttccg

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450199
Entry
6450199           tRNA      T01015                                 
Symbol
trnS, OrsajM_t16
Name
(RefSeq) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450199 (trnS)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450199 (trnS)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450199 (trnS)
SSDB
Other DBs
NCBI-GeneID: 6450199
LinkDB
Position
MT:336728..336815
NT seq 88 nt   +upstreamnt  +downstreamnt
ggaggtatggctgagtggcttaaggcattggtttgctaaatcgacatacaagaagattgt
atcatgggttcgaatcccatttcctccg

DBGET integrated database retrieval system