KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131344
Entry
3131344           tRNA      T01015                                 
Symbol
OrsajCt127
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131344 (OrsajCt127)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131344 (OrsajCt127)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131344 (OrsajCt127)
SSDB
Other DBs
NCBI-GeneID: 3131344
LinkDB
Position
Pltd:complement(12839..12912)
NT seq 74 nt   +upstreamnt  +downstreamnt
agcggagtagagcagtttggtagctcacgaggctcataaccttgaggtcacgggttcgat
tcccgtctccgcac

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131357
Entry
3131357           tRNA      T01015                                 
Symbol
OrsajCt142
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131357 (OrsajCt142)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131357 (OrsajCt142)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131357 (OrsajCt142)
SSDB
Other DBs
NCBI-GeneID: 3131357
LinkDB
Position
Pltd:51219..51291
NT seq 73 nt   +upstreamnt  +downstreamnt
gcctacttaactcagtggttagagtattgctttcatacggcgggagtcattggttcaaat
ccaatagtaggta

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131361
Entry
3131361           tRNA      T01015                                 
Symbol
OrsajCt146
Name
(RefSeq) tRNA-Ile
  KO
K14230  tRNA Met
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131361 (OrsajCt146)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131361 (OrsajCt146)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131361 (OrsajCt146)
SSDB
Other DBs
NCBI-GeneID: 3131361
LinkDB
Position
Pltd:complement(83139..83212)
NT seq 74 nt   +upstreamnt  +downstreamnt
gcatccatggctgaatggttaaagcgcccaactcataattggtaaatttgcgggttcaat
tcctgctggatgca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131383
Entry
3131383           tRNA      T01015                                 
Symbol
OrsajCt160
Name
(RefSeq) tRNA-Ile
  KO
K14230  tRNA Met
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131383 (OrsajCt160)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131383 (OrsajCt160)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131383 (OrsajCt160)
SSDB
Other DBs
NCBI-GeneID: 3131383
LinkDB
Position
Pltd:131906..131979
NT seq 74 nt   +upstreamnt  +downstreamnt
gcatccatggctgaatggttaaagcgcccaactcataattggtaaatttgcgggttcaat
tcctgctggatgca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450127
Entry
6450127           tRNA      T01015                                 
Symbol
trnM, OrsajM_t03
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450127 (trnM)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450127 (trnM)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450127 (trnM)
SSDB
Other DBs
NCBI-GeneID: 6450127
LinkDB
Position
MT:26189..26261
NT seq 73 nt   +upstreamnt  +downstreamnt
gcctacttaactcagtggttagagtattgctttcatacggcgggagtcattggttcaaat
ccaatagtaggta

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450158
Entry
6450158           tRNA      T01015                                 
Symbol
trnfM, OrsajM_t14
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450158 (trnfM)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450158 (trnfM)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450158 (trnfM)
SSDB
Other DBs
NCBI-GeneID: 6450158
LinkDB
Position
MT:complement(188545..188618)
NT seq 74 nt   +upstreamnt  +downstreamnt
agcggggtagaggaattggtcaactcatcaggctcatgacctgaagactgcaggttcgaa
tcctgtccccgcct

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450184
Entry
6450184           tRNA      T01015                                 
Symbol
trnI, OrsajM_t10
Name
(RefSeq) tRNA-Ile
  KO
K14230  tRNA Met
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450184 (trnI)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450184 (trnI)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450184 (trnI)
SSDB
Other DBs
NCBI-GeneID: 6450184
LinkDB
Position
MT:complement(64083..64156)
NT seq 74 nt   +upstreamnt  +downstreamnt
gggcttatagtttaattggttgaaacgtaccgctcataacggtgatattgtaggttcgag
ccctactaagccca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450187
Entry
6450187           tRNA      T01015                                 
Symbol
trnM, OrsajM_t08
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450187 (trnM)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450187 (trnM)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450187 (trnM)
SSDB
Other DBs
NCBI-GeneID: 6450187
LinkDB
Position
MT:complement(54284..54356)
NT seq 73 nt   +upstreamnt  +downstreamnt
acctacttgactcagcggttagagtatcgctttcatacggcgagagtcattggttcaaat
ccaatagtaggta

DBGET integrated database retrieval system