KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131346
Entry
3131346           tRNA      T01015                                 
Symbol
OrsajCt130
Name
(RefSeq) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131346 (OrsajCt130)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131346 (OrsajCt130)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131346 (OrsajCt130)
SSDB
Other DBs
NCBI-GeneID: 3131346
LinkDB
Position
Pltd:15060..15131
NT seq 72 nt   +upstreamnt  +downstreamnt
gcccttttaactcagtggtagagtaatgccatggtaaggcataagtcatcggttcaaatc
cgataaagggct

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131353
Entry
3131353           tRNA      T01015                                 
Symbol
OrsajCt138
Name
(RefSeq) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131353 (OrsajCt138)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131353 (OrsajCt138)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131353 (OrsajCt138)
SSDB
Other DBs
NCBI-GeneID: 3131353
LinkDB
Position
Pltd:complement(45715..45787)
NT seq 73 nt   +upstreamnt  +downstreamnt
gcccacttagctcagaggttagagcatcgcatttgtaatgcgagggtcatcggttcaaat
ccgatagtcggct

DBGET integrated database retrieval system