KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131347
Entry
3131347           tRNA      T01015                                 
Symbol
OrsajCt132
Name
(RefSeq) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131347 (OrsajCt132)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131347 (OrsajCt132)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131347 (OrsajCt132)
SSDB
Other DBs
NCBI-GeneID: 3131347
LinkDB
Position
Pltd:15650..15722
NT seq 73 nt   +upstreamnt  +downstreamnt
gcccctatcgtctagtggttcaggacatctctctttcaaggaggcagcggggattcgact
tcccctgggggta

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450160
Entry
6450160           tRNA      T01015                                 
Symbol
trnE, OrsajM_t20
Name
(RefSeq) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450160 (trnE)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450160 (trnE)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450160 (trnE)
SSDB
Other DBs
NCBI-GeneID: 6450160
LinkDB
Position
MT:376067..376138
NT seq 72 nt   +upstreamnt  +downstreamnt
gtccctttcgtccagtggttaggacatcgtcttttcatgtcgaagacacgggttcgattc
ccgtaagggata

DBGET integrated database retrieval system