KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131348
Entry
3131348           tRNA      T01015                                 
Symbol
OrsajCt133
Name
(RefSeq) tRNA-Tyr
  KO
K14236  tRNA Tyr
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131348 (OrsajCt133)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131348 (OrsajCt133)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131348 (OrsajCt133)
SSDB
Other DBs
NCBI-GeneID: 3131348
LinkDB
Position
Pltd:15784..15867
NT seq 84 nt   +upstreamnt  +downstreamnt
gggtcgatgcccgagcggttaatggggacggactgtaaattcgttgacaatatgtctacg
ctggttcaaatccagctcggccca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450129
Entry
6450129           tRNA      T01015                                 
Symbol
trnY, OrsajM_t19
Name
(RefSeq) tRNA-Tyr
  KO
K14236  tRNA Tyr
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450129 (trnY)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450129 (trnY)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450129 (trnY)
SSDB
Other DBs
NCBI-GeneID: 6450129
LinkDB
Position
MT:363110..363192
NT seq 83 nt   +upstreamnt  +downstreamnt
gggagagtggccgagcggtcaaaagcgacagactgtaaatctgttgaaggttttctacgt
aggttcgaatcctgcctctccca

DBGET integrated database retrieval system