KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131350
Entry
3131350           tRNA      T01015                                 
Symbol
OrsajCt135
Name
(RefSeq) tRNA-Cys
  KO
K14222  tRNA Cys
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131350 (OrsajCt135)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131350 (OrsajCt135)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131350 (OrsajCt135)
SSDB
Other DBs
NCBI-GeneID: 3131350
LinkDB
Position
Pltd:complement(18059..18129)
NT seq 71 nt   +upstreamnt  +downstreamnt
ggcggcatggccaagcggtaaggcaggggactgcaaatcctttatccccagttcaaatct
gggtgccgcct

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450176
Entry
6450176           tRNA      T01015                                 
Symbol
trnC, OrsajM_t21
Name
(RefSeq) tRNA-Cys
  KO
K14222  tRNA Cys
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450176 (trnC)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450176 (trnC)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450176 (trnC)
SSDB
Other DBs
NCBI-GeneID: 6450176
LinkDB
Position
MT:complement(390806..390876)
NT seq 71 nt   +upstreamnt  +downstreamnt
ggcggcatggccaagcggtaaggcaggggactgcaaatcctttatccccagttcaaatct
gggtgccgcct

DBGET integrated database retrieval system