KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131351
Entry
3131351           tRNA      T01015                                 
Symbol
OrsajCt136
Name
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131351 (OrsajCt136)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131351 (OrsajCt136)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131351 (OrsajCt136)
SSDB
Other DBs
NCBI-GeneID: 3131351
LinkDB
Position
Pltd:complement(35866..35937)
NT seq 72 nt   +upstreamnt  +downstreamnt
gcgtccattgtctaatggataggacagaggtcttctaaacctttggtataggttcaaatc
ctattggacgca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131370
Entry
3131370           tRNA      T01015                                 
Symbol
OrsajCt151
Name
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131370 (OrsajCt151)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131370 (OrsajCt151)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131370 (OrsajCt151)
SSDB
Other DBs
NCBI-GeneID: 3131370
LinkDB
Position
Pltd:98891..98964
NT seq 74 nt   +upstreamnt  +downstreamnt
gggcctgtagctcagaggattagagcacgtggctacgaaccacggtgtcgggggttcgaa
tccctcctcgccca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131374
Entry
3131374           tRNA      T01015                                 
Symbol
OrsajCt155
Name
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131374 (OrsajCt155)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131374 (OrsajCt155)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131374 (OrsajCt155)
SSDB
Other DBs
NCBI-GeneID: 3131374
LinkDB
Position
Pltd:complement(116154..116227)
NT seq 74 nt   +upstreamnt  +downstreamnt
gggcctgtagctcagaggattagagcacgtggctacgaaccacggtgtcgggggttcgaa
tccctcctcgccca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450163
Entry
6450163           tRNA      T01015                                 
Symbol
trnR, OrsajM_t22
Name
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450163 (trnR)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450163 (trnR)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450163 (trnR)
SSDB
Other DBs
NCBI-GeneID: 6450163
LinkDB
Position
MT:complement(407229..407300)
NT seq 72 nt   +upstreamnt  +downstreamnt
gcgtccattgtctaatggataggacagaggtcttctaaacctttggtataggttcaaatc
ctattggacgca

DBGET integrated database retrieval system