KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131354
Entry
3131354           tRNA      T01015                                 
Symbol
OrsajCt139
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131354 (OrsajCt139)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131354 (OrsajCt139)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131354 (OrsajCt139)
SSDB
Other DBs
NCBI-GeneID: 3131354
LinkDB
Position
Pltd:46558..47182
NT seq 85 nt   +upstreamnt  +downstreamnt
ggggatatggcgaaatcggtagacgctacggacttaaaatccgtcgactttctaagtcgt
gagggttcaagtccctctatcccca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131362
Entry
3131362           tRNA      T01015                                 
Symbol
OrsajCt147
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131362 (OrsajCt147)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131362 (OrsajCt147)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131362 (OrsajCt147)
SSDB
Other DBs
NCBI-GeneID: 3131362
LinkDB
Position
Pltd:complement(84711..84791)
NT seq 81 nt   +upstreamnt  +downstreamnt
gccttgatggtgaaatggtagacacgcgagactcaaaatctcgtgctaaagagcgtggag
gttcgagtcctcttcaaggca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131372
Entry
3131372           tRNA      T01015                                 
Symbol
OrsajCt153
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131372 (OrsajCt153)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131372 (OrsajCt153)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131372 (OrsajCt153)
SSDB
Other DBs
NCBI-GeneID: 3131372
LinkDB
Position
Pltd:105074..105153
NT seq 80 nt   +upstreamnt  +downstreamnt
gccgccatggtgaaattggtagacacgctgctcttaggaagcagtgctcaagcatctcgg
ttcgagtccgagtggcggca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131382
Entry
3131382           tRNA      T01015                                 
Symbol
OrsajCt159
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131382 (OrsajCt159)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131382 (OrsajCt159)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131382 (OrsajCt159)
SSDB
Other DBs
NCBI-GeneID: 3131382
LinkDB
Position
Pltd:130327..130407
NT seq 81 nt   +upstreamnt  +downstreamnt
gccttgatggtgaaatggtagacacgcgagactcaaaatctcgtgctaaagagcgtggag
gttcgagtcctcttcaaggca

DBGET integrated database retrieval system