KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131355
Entry
3131355           tRNA      T01015                                 
Symbol
OrsajCt140
Name
(RefSeq) tRNA-Phe
  KO
K14231  tRNA Phe
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131355 (OrsajCt140)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131355 (OrsajCt140)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131355 (OrsajCt140)
SSDB
Other DBs
NCBI-GeneID: 3131355
LinkDB
Position
Pltd:47425..47497
NT seq 73 nt   +upstreamnt  +downstreamnt
gtcaggatagctcagttggtagagcagaggactgaaaatcctcgtgtcaccagttcaaat
ctggttcctggca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450188
Entry
6450188           tRNA      T01015                                 
Symbol
trnF, OrsajM_t18
Name
(RefSeq) tRNA-Phe
  KO
K14231  tRNA Phe
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450188 (trnF)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450188 (trnF)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450188 (trnF)
SSDB
Other DBs
NCBI-GeneID: 6450188
LinkDB
Position
MT:359447..359549
NT seq 103 nt   +upstreamnt  +downstreamnt
gtactctactaggatgatgcacaataaatggtcaggatagctcagttggtagagcagagg
actgaaaatcctcgtgtcaccagttcaaatctggttcctggca

DBGET integrated database retrieval system