KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131359
Entry
3131359           tRNA      T01015                                 
Symbol
OrsajCt144
Name
(RefSeq) tRNA-Pro
  KO
K14232  tRNA Pro
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131359 (OrsajCt144)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131359 (OrsajCt144)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131359 (OrsajCt144)
SSDB
Other DBs
NCBI-GeneID: 3131359
LinkDB
Position
Pltd:complement(64229..64303)
NT seq 75 nt   +upstreamnt  +downstreamnt
aagggatgtagcgcagcttggtagcgcgtttgttttgggtacaaaatgtcacaggttcaa
atcctgtcatcccta

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450141
Entry
6450141           tRNA      T01015                                 
Symbol
trnP, OrsajM_t05
Name
(RefSeq) pseudogene
  KO
K14232  tRNA Pro
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450141 (trnP)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450141 (trnP)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450141 (trnP)
SSDB
Other DBs
NCBI-GeneID: 6450141
LinkDB
Position
MT:35219..35292
NT seq 74 nt   +upstreamnt  +downstreamnt
agggatgtagcgcagcttggtagcgcgttcgttttgggtacaaaatgtcacgggttcaaa
tcctgtcatcccta

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450194
Entry
6450194           tRNA      T01015                                 
Symbol
trnP, OrsajM_t01
Name
(RefSeq) tRNA-Pro
  KO
K14232  tRNA Pro
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450194 (trnP)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450194 (trnP)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450194 (trnP)
SSDB
Other DBs
NCBI-GeneID: 6450194
LinkDB
Position
MT:9778..9852
NT seq 75 nt   +upstreamnt  +downstreamnt
cgaggtgtagcgcagtctggtcagcgcatctgttttgggtacagagggccataggttcga
atcctgtcaccttga

DBGET integrated database retrieval system