KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131360
Entry
3131360           tRNA      T01015                                 
Symbol
OrsajCt145
Name
(RefSeq) tRNA-His
  KO
K14226  tRNA His
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131360 (OrsajCt145)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131360 (OrsajCt145)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131360 (OrsajCt145)
SSDB
Other DBs
NCBI-GeneID: 3131360
LinkDB
Position
Pltd:81050..81124
NT seq 75 nt   +upstreamnt  +downstreamnt
ggcggatgtagccaagtggatcaaggcagtggattgtgaatccaccatgcgcgggttcaa
ttcccgtcgttcgcc

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131384
Entry
3131384           tRNA      T01015                                 
Symbol
OrsajCt161
Name
(RefSeq) tRNA-His
  KO
K14226  tRNA His
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131384 (OrsajCt161)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131384 (OrsajCt161)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131384 (OrsajCt161)
SSDB
Other DBs
NCBI-GeneID: 3131384
LinkDB
Position
Pltd:complement(133991..134068)
NT seq 78 nt   +upstreamnt  +downstreamnt
ggcggatgtagccaagtggatcaaggcagtggattgtgaatccaccatgcgcgggttcaa
ttcccgtcgttcgcccat

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450165
Entry
6450165           tRNA      T01015                                 
Symbol
trnH, OrsajM_t04
Name
(RefSeq) tRNA-His
  KO
K14226  tRNA His
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    6450165 (trnH)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450165 (trnH)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  6450165 (trnH)
SSDB
Other DBs
NCBI-GeneID: 6450165
LinkDB
Position
MT:complement(32203..32276)
NT seq 74 nt   +upstreamnt  +downstreamnt
gcggatgtagccaagtggatcaaggcagtggattgtgaatccaccatgcgcgggttcaat
tcccgtcgttcgcc

DBGET integrated database retrieval system