KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131363
Entry
3131363           tRNA      T01015                                 
Symbol
OrsajCt148
Name
(RefSeq) tRNA-Val
  KO
K14237  tRNA Val
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131363 (OrsajCt148)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131363 (OrsajCt148)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131363 (OrsajCt148)
SSDB
Other DBs
NCBI-GeneID: 3131363
LinkDB
Position
Pltd:90996..91067
NT seq 72 nt   +upstreamnt  +downstreamnt
agggatataactcagcggtagagtgtcaccttgacgtggtggaagtcatcagttcgagcc
tgattatcccta

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131381
Entry
3131381           tRNA      T01015                                 
Symbol
OrsajCt158
Name
(RefSeq) tRNA-Val
  KO
K14237  tRNA Val
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131381 (OrsajCt158)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131381 (OrsajCt158)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131381 (OrsajCt158)
SSDB
Other DBs
NCBI-GeneID: 3131381
LinkDB
Position
Pltd:complement(124051..124122)
NT seq 72 nt   +upstreamnt  +downstreamnt
agggatataactcagcggtagagtgtcaccttgacgtggtggaagtcatcagttcgagcc
tgattatcccta

DBGET integrated database retrieval system