KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131365
Entry
3131365           tRNA      T01015                                 
Symbol
OrsajCt149
Name
(RefSeq) tRNA-Ile
  KO
K14227  tRNA Ile
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131365 (OrsajCt149)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131365 (OrsajCt149)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131365 (OrsajCt149)
SSDB
Other DBs
NCBI-GeneID: 3131365
LinkDB
Position
Pltd:93100..94118
NT seq 72 nt   +upstreamnt  +downstreamnt
gggctattagctcagtggtagagcgcgcccctgataagggcgaggtctctggttcaagtc
caggatggccca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131379
Entry
3131379           tRNA      T01015                                 
Symbol
OrsajCt157
Name
(RefSeq) tRNA-Ile
  KO
K14227  tRNA Ile
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131379 (OrsajCt157)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131379 (OrsajCt157)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131379 (OrsajCt157)
SSDB
Other DBs
NCBI-GeneID: 3131379
LinkDB
Position
Pltd:complement(121000..122018)
NT seq 72 nt   +upstreamnt  +downstreamnt
gggctattagctcagtggtagagcgcgcccctgataagggcgaggtctctggttcaagtc
caggatggccca

DBGET integrated database retrieval system