KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131366
Entry
3131366           tRNA      T01015                                 
Symbol
OrsajCt150
Name
(RefSeq) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131366 (OrsajCt150)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131366 (OrsajCt150)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131366 (OrsajCt150)
SSDB
Other DBs
NCBI-GeneID: 3131366
LinkDB
Position
Pltd:94183..95067
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggatatagctcagttggtagagctccgctcttgcaaggcggatgtcagcggttcgagt
ccgcttatctcca

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131378
Entry
3131378           tRNA      T01015                                 
Symbol
OrsajCt156
Name
(RefSeq) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131378 (OrsajCt156)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131378 (OrsajCt156)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131378 (OrsajCt156)
SSDB
Other DBs
NCBI-GeneID: 3131378
LinkDB
Position
Pltd:complement(120051..120935)
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggatatagctcagttggtagagctccgctcttgcaaggcggatgtcagcggttcgagt
ccgcttatctcca

DBGET integrated database retrieval system