KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131369
Entry
3131369           rRNA      T01015                                 
Symbol
OrsajCr116
Name
(RefSeq) 5S ribosomal RNA
  KO
K01981  large subunit ribosomal RNA, 5S
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa03008  Ribosome biogenesis in eukaryotes
osa03010  Ribosome
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    3131369 (OrsajCr116)
   03008 Ribosome biogenesis in eukaryotes
    3131369 (OrsajCr116)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:osa03011]
    3131369 (OrsajCr116)
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131369 (OrsajCr116)
Ribosome [BR:osa03011]
 Ribosomal RNAs
  Eukaryotes
   3131369 (OrsajCr116)
Non-coding RNAs [BR:osa03100]
 Ribosomal RNA
  Large subunit rRNA
   3131369 (OrsajCr116)
SSDB
Other DBs
NCBI-GeneID: 3131369
LinkDB
Position
Pltd:98514..98634
NT seq 121 nt   +upstreamnt  +downstreamnt
tattctggtgtcctaggcgtagaggaaccacaccaatccatcccgaatttggtggttaaa
ctctactgcggtgacgatactgtaggggaggtcctgcggcaaaatagctcgatgccagaa
t

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131375
Entry
3131375           rRNA      T01015                                 
Symbol
OrsajCr117
Name
(RefSeq) 5S ribosomal RNA
  KO
K01981  large subunit ribosomal RNA, 5S
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa03008  Ribosome biogenesis in eukaryotes
osa03010  Ribosome
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    3131375 (OrsajCr117)
   03008 Ribosome biogenesis in eukaryotes
    3131375 (OrsajCr117)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:osa03011]
    3131375 (OrsajCr117)
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131375 (OrsajCr117)
Ribosome [BR:osa03011]
 Ribosomal RNAs
  Eukaryotes
   3131375 (OrsajCr117)
Non-coding RNAs [BR:osa03100]
 Ribosomal RNA
  Large subunit rRNA
   3131375 (OrsajCr117)
SSDB
Other DBs
NCBI-GeneID: 3131375
LinkDB
Position
Pltd:complement(116484..116604)
NT seq 121 nt   +upstreamnt  +downstreamnt
tattctggtgtcctaggcgtagaggaaccacaccaatccatcccgaatttggtggttaaa
ctctactgcggtgacgatactgtaggggaggtcctgcggcaaaatagctcgatgccagaa
t

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 6450136
Entry
6450136           rRNA      T01015                                 
Symbol
rrn5, OrsajM_r01
Name
(RefSeq) 5S ribosomal RNA
  KO
K01981  large subunit ribosomal RNA, 5S
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa03008  Ribosome biogenesis in eukaryotes
osa03010  Ribosome
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    6450136 (rrn5)
   03008 Ribosome biogenesis in eukaryotes
    6450136 (rrn5)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:osa03011]
    6450136 (rrn5)
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    6450136 (rrn5)
Ribosome [BR:osa03011]
 Ribosomal RNAs
  Eukaryotes
   6450136 (rrn5)
Non-coding RNAs [BR:osa03100]
 Ribosomal RNA
  Large subunit rRNA
   6450136 (rrn5)
SSDB
Other DBs
NCBI-GeneID: 6450136
LinkDB
Position
MT:complement(282532..282653)
NT seq 122 nt   +upstreamnt  +downstreamnt
aaaccgggcactacggtgagacgtgaaaacacccgatcccattccgacctcgatatatat
gtggaatcgtcttgcgccatatgtactgaaattgttcgggagacatggtcaaagcccggg
gt

DBGET integrated database retrieval system