KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131371
Entry
3131371           tRNA      T01015                                 
Symbol
OrsajCt152
Name
(RefSeq) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131371 (OrsajCt152)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131371 (OrsajCt152)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131371 (OrsajCt152)
SSDB
Other DBs
NCBI-GeneID: 3131371
LinkDB
Position
Pltd:complement(99216..99287)
NT seq 72 nt   +upstreamnt  +downstreamnt
tcctcagtagctcagtggtagagcggtcggctgttaactgactggtcgtaggttcgaatc
ctacttggggag

KEGG   Oryza sativa japonica (Japanese rice) (RefSeq): 3131373
Entry
3131373           tRNA      T01015                                 
Symbol
OrsajCt154
Name
(RefSeq) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
osa  Oryza sativa japonica (Japanese rice) (RefSeq)
Pathway
osa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:osa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    3131373 (OrsajCt154)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:osa03100]
    3131373 (OrsajCt154)
Non-coding RNAs [BR:osa03100]
 Transfer RNA
  3131373 (OrsajCt154)
SSDB
Other DBs
NCBI-GeneID: 3131373
LinkDB
Position
Pltd:115831..115902
NT seq 72 nt   +upstreamnt  +downstreamnt
tcctcagtagctcagtggtagagcggtcggctgttaactgactggtcgtaggttcgaatc
ctacttggggag

DBGET integrated database retrieval system