Pseudomyxococcus flavus: VZL07_30590 Help Entry VZL07_30590       CDS       T11142                                  Name (GenBank) MbtH family protein   KO K05375   MbtH protein Organism pfly  Pseudomyxococcus flavus Pathway pfly00261   Monobactam biosynthesis pfly01100   Metabolic pathways pfly01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:pfly00001]  09100 Metabolism   09110 Biosynthesis of other secondary metabolites    00261 Monobactam biosynthesis     VZL07_30590  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:pfly01008]     VZL07_30590 Polyketide biosynthesis proteins [BR:pfly01008]  Nonribosomal peptide synthetase (NRPS)   Linear NRPS    Nocardicin synthetase     VZL07_30590 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MbtH Motif Other DBs NCBI-ProteinID:  XSE94711 LinkDB All DBs Position complement(7382090..7382308) Genome browser AA seq 72 aa AA seqDB search MADEREDTTIYKVVVNHEEQYSIWPADRENALGWKDAGKQGLKAECLEYIKEVWTDMRPL SLRKKMEEMSKQ NT seq 219 nt NT seq  +upstreamnt  +downstreamnt atggcggatgagcgcgaggacacgaccatctacaaggtcgtggtgaaccacgaggagcag tactccatctggcctgccgaccgcgagaacgcgctcggctggaaggatgcgggcaagcag ggcctcaaggccgagtgcctcgagtacatcaaggaggtctggacggacatgcgtccgctg agcctccgcaagaagatggaagagatgtcgaagcagtag

DBGET integrated database retrieval system