Teredinibacter turnerae: TERTU_0399 Help Entry TERTU_0399        CDS       T00952                                  Name (GenBank) conserved hypothetical protein   KO K09892   cell division protein ZapB Organism ttu  Teredinibacter turnerae Brite KEGG Orthology (KO) [BR:ttu00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:ttu03036]     TERTU_0399 Chromosome and associated proteins [BR:ttu03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     TERTU_0399 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB CALCOCO1 DUF7491 Syntaxin MctB DivIC Motif Other DBs NCBI-ProteinID:  ACR13462 UniProt:  C5BMD5 LinkDB All DBs Position complement(418758..418961) Genome browser AA seq 67 aa AA seqDB search MTDKLINEVEHKLDKLINLCTRLQQENASLRAEKSEWQQERSRLIEKNQLARTRVEAMIE RLRNMEA NT seq 204 nt NT seq  +upstreamnt  +downstreamnt atgaccgataaactcatcaacgaggttgaacacaagctggataagctcatcaacctttgc acacgactgcaacaggagaacgcaagcctgcgcgccgaaaaaagcgagtggcaacaggaa cggagccggctgatcgaaaaaaatcagctcgcgcgcacccgtgttgaagccatgattgaa cgtttgcgcaacatggaggcctag

DBGET integrated database retrieval system