KEGG   Cupriavidus sp. USMAA1020: BKK80_17140Help
Entry
BKK80_17140       CDS       T04978                                 

Definition
(GenBank) phosphoenolpyruvate carboxylase
  KO
K01595  
phosphoenolpyruvate carboxylase [EC:4.1.1.31]
Organism
cup  Cupriavidus sp. USMAA1020
Pathway
Pyruvate metabolism
Methane metabolism
Carbon fixation in photosynthetic organisms
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
CAM (Crassulacean acid metabolism), dark
Brite
KEGG Orthology (KO) [BR:cup00001]
 Metabolism
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    BKK80_17140
  Energy metabolism
   00710 Carbon fixation in photosynthetic organisms
    BKK80_17140
   00680 Methane metabolism
    BKK80_17140
Enzymes [BR:cup01000]
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.1  Carboxy-lyases
    4.1.1.31  phosphoenolpyruvate carboxylase
     BKK80_17140
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
LinkDB All DBs
Position
1:3788287..3791370
Genome map
AA seq 1027 aa AA seqDB search
MTQPAARPAGRGAASAARSPAPASGQPADPQESKPSPRRRTAKSAKASGTATTAKVTGKT
PAANAASIGKAAGATRAAVEGTTGSAARRSADKDLPLREDIRFLGRLLGDCLREQEGEAA
FDVVETIRQTAVRFRRENDRAAGAELDRLLKRLSRDQTNSVVRAFSYFSHLANIAEDQHH
NRRRRVHALAGSPPQPGSLERALADIDAAGVTGKALRKFFDEALIVPVLTAHPTEVQRKS
ILDAEREIARLLAERDLPMTAREREQNTARLRACVTTLWQTRMLRNTRLMVVDEIENALS
YYRTTFLRGIPQLVSELEDDIAKAFPAARKGQGNVPARRLPPFFQMGTWIGGDRDGNPNV
TAETLNYAARQQSMLILEWYLDELHALGAELSMSSLMVEASPALLALAEASPDRSEHRAD
EPYRRALIGIYARLAATSQALTGHAAPRHPVADAEPYANAEALAADVQVVIDSLRAHHGE
ALARTRIDALARAIDIFGFHLASIDMRQVSDVHEAVVAELFATSGVEADYAALPEARKLE
LLLAELRQPRLLTLPWHAYSEQTRNELAIFAKARELRARYGKRVARNYIISHTETLSDLI
EVMLLQKETGLLTGALGDRRDPARMELMVIPLFETIEDLRNAAGIMQSLLDLPGFASVLA
HHGGEQEVMLGYSDSNKDGGFLTSNWELYQAELALVQLFEARKVKLRLFHGRGGTVGRGG
GPTYQAILSQPPGTVNGQIRLTEQGEIINSKFANAEIGRRNLETVIAATLEASLLPTQNA
PKDLAAFEAAMQQLSDHAFRAYRDLVYETPGFKDYFFSTTPITEIADLNLGSRPASRKLM
DKKGRRIEDLRAIPWGFSWGQCRLLLPGWYGFGSAVKAMLDGCADERAHKAALGTLRRMV
KQWPFFSTLLSNMDMVLSKTDLAVASRYAQLCDDAALRKKVFSRISAEWHLTCEMLALIT
GRQERLAENPLLARSIKNRFAYLDPLNHLQVELLKRFRSGKDGDDIRVRRGIHLTINGVA
AGLRNTG
NT seq 3084 nt NT seq  +upstreamnt  +downstreamnt
atgacgcagcccgctgcgcgccccgccggccgaggagccgcctcggccgcccgtagcccc
gcccccgcttccggccaacccgccgacccccaggaatccaaaccctccccgcgccgcagg
acagcgaaatccgccaaggcaagcggcacggcgaccaccgccaaggtgaccggtaagaca
cccgccgccaatgcggcgtcgatcggcaaggctgccggcgcgacccgtgccgcagtggaa
ggcaccaccggctccgctgcgcgccgcagcgccgacaaggacctgccgctgcgcgaggac
atccgcttcctcggccgcctgctcggcgactgcctgcgcgagcaggaaggcgaggcggcc
ttcgacgtggtcgaaaccatccgccagaccgcggtgcgcttccgccgcgagaacgaccgc
gccgcgggtgccgaactcgaccgcctgctcaagcggctgtcgcgcgaccagaccaactcg
gtggtacgcgccttcagctacttctcgcacctggccaatatcgccgaggaccagcaccac
aaccgccgccgccgcgtgcacgcgctggccggctcgccaccgcagccgggcagcctggag
cgcgcgctggccgatatcgatgccgccggagtgaccgggaaggcactgcgcaagttcttc
gacgaggcactgatcgtgccggtgctgaccgcccacccgaccgaggtgcagcgcaagagc
atcctcgacgccgaacgcgagatcgcccgcctgctggccgagcgcgacctgcccatgacc
gcgcgtgagcgcgaacagaacacggcgcgcctgcgcgcctgcgtgaccacgctgtggcag
acccgcatgctgcgcaacacgcgcctgatggtggtcgacgagatcgagaacgcgctgtcg
tactaccgcacgaccttcctgcgcggcatcccgcaactcgtcagcgagctggaggacgat
atcgccaaggccttcccggccgcccgcaagggccagggcaatgtccccgcgcgccggctg
ccgcccttcttccagatgggcacgtggatcggcggcgaccgcgacggcaatcccaacgtc
accgccgagacgctgaattacgcggcgcggcagcagtcgatgctgatcctggagtggtat
ctcgacgagctgcacgcgctgggcgccgaactgtcgatgtcgagcctgatggtggaggcc
agccccgccttgctggccctggccgaagcctcgcccgaccgctccgaacaccgcgccgac
gagccctaccgccgcgcgctgatcggcatctacgcgcgccttgccgccaccagccaggcc
ctgacaggccacgccgcgccgcgccacccggtggccgacgccgaaccatacgccaatgcc
gaggcgctggccgccgacgtgcaggtggtgatcgattcgctgcgcgcccaccacggcgag
gcactggcgcgcacccgcatcgacgcgctggcgcgcgccatcgacatcttcggcttccat
ctggcctcgatcgacatgcgccaggtctccgacgtgcacgaggcggtggttgccgagctg
ttcgccacctccggggtggaggccgattacgccgccctgcccgaggcgcgcaagctcgag
ctgctgctcgccgaactgcgccagccgcgcctgctgaccctgccctggcacgcttattcc
gagcagacccgcaacgagctggccatcttcgccaaggcgcgcgaactgcgtgcccgctac
ggcaagcgcgtggcgcgcaactacatcatctcgcacaccgagacgctgtccgacctgatc
gaggtgatgctgctgcagaaggaaaccggcctgctgaccggcgcactgggcgaccggcgc
gacccggcgcgcatggaactgatggtgatccccctgttcgagaccatcgaggacttgcgc
aatgccgccggcatcatgcagtcgctgctggacctgccgggcttcgcctcggtgctggcc
caccacggcggcgagcaggaagtgatgctgggctattcggattccaacaaggacggcggc
ttcctcacctcgaactgggagctctaccaggccgagctggccctggtccagctgttcgag
gcgcgcaaggtcaagctgcgcctgttccacggccgcggcggcaccgtcggacgcggcggt
ggcccgacctaccaggccatcctgtcgcagccgccaggcacggtcaacggccagatccgc
ctgaccgagcagggcgagatcatcaacagcaagttcgccaacgccgagatcggccggcgc
aacctggagacggtgatcgccgccacgctggaggcctcgctgctgccgacacagaacgct
cccaaggacctggccgccttcgaggcggcaatgcagcagttgtccgaccacgccttccgc
gcctaccgcgacctggtctacgagacgccgggcttcaaggactacttcttctccaccacg
ccgatcaccgagatcgccgacctgaacctgggttcgcggccggcttcgcgcaagctgatg
gacaagaaaggccgccgcatcgaagacctgcgcgccattccctggggcttctcctggggc
cagtgccgcctgctgctgcctggctggtacggcttcggcagcgcggtcaaggccatgctc
gacggctgcgccgacgagcgcgcccacaaggctgcgctgggtaccctgcggcgcatggtc
aagcaatggccgttcttctccacgctgctgtccaatatggacatggtgctgtccaagacg
gacctggcggtggcctcgcgctacgcccagctgtgcgatgacgcggcgctgcgcaagaaa
gtgttctcgcgcatcagcgccgaatggcacctgacctgcgagatgctggcgctgatcacg
ggccgccaggaacggctggcggagaacccgctgctggcgcgctcgatcaagaaccgcttc
gcctacctcgatccgctgaaccacctgcaggtcgagctgctcaagcgcttccgctcgggc
aaggacggcgacgatatccgcgtccggcgcggcatccacctgaccatcaacggcgtcgcg
gccggcctgcgcaacacaggctga

DBGET integrated database retrieval system