KEGG   Enterobacter xiangfangensis: BFV63_09720Help
Entry
BFV63_09720       CDS       T04821                                 

Definition
(GenBank) glutathione transferase GstA
  KO
K00799  
glutathione S-transferase [EC:2.5.1.18]
Organism
exf  Enterobacter xiangfangensis
Pathway
Glutathione metabolism
Brite
KEGG Orthology (KO) [BR:exf00001]
 Metabolism
  Metabolism of other amino acids
   00480 Glutathione metabolism
    BFV63_09720
Enzymes [BR:exf01000]
 2. Transferases
  2.5  Transferring alkyl or aryl groups, other than methyl groups
   2.5.1  Transferring alkyl or aryl groups, other than methyl groups (only sub-subclass identified to date)
    2.5.1.18  glutathione transferase
     BFV63_09720
Transporters [BR:exf02000]
 Other Transporters
  Pores ion channels [TC:1]
   BFV63_09720
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
complement(2018390..2018995)
Genome map
AA seq 201 aa AA seqDB search
MKLFYKPGACSLASHITLRESGKDFTLDGVDLMKKRLENGDDFFAINPKGQVPALLLDDG
TLLTEGVAIMQFLADNVPDRQLLAPTGSIARYKTLEWLNYIATELHKGFTPLFRPDTPEE
YKPTVRALLEKKLQYVNDALKDDQWICGSRFTIADAYLFTVLRWARAVKLNMEGLDHVAS
YMTRVAERPAVAAALKAEGLN
NT seq 606 nt NT seq  +upstreamnt  +downstreamnt
atgaaactgttctataaaccgggcgcctgctctcttgcttcccatattacgcttcgcgag
agcggtaaagatttcacgctggacggcgttgacctgatgaaaaagcgcctggaaaacggg
gatgacttttttgcgattaacccaaaagggcaggttccggccctgctgctggatgatggc
accctgctgaccgaaggggtggcgattatgcaattcctggcggacaacgtaccggatcgt
cagctccttgcccccaccggcagcattgcgcgttataagacgctggagtggctgaactat
attgccaccgaactgcacaaaggctttacgcccctgttccgcccggacacgccagaagag
tacaaacctaccgtgcgcgcgctgctggagaaaaagttgcagtacgttaacgacgcgctg
aaagacgaccagtggatctgtggctcgcgtttcactatcgccgatgcctatctgtttacc
gttctgcgctgggcgcgcgcggttaagttgaacatggaaggattagaccatgtcgcctcg
tatatgacgcgcgtggcggagcgtcctgcggtggcggcggcgctgaaagcggaagggttg
aattaa

DBGET integrated database retrieval system