KEGG   Leptolyngbya boryana: LBWT_48720Help
Entry
LBWT_48720        CDS       T04848                                 

Definition
(GenBank) SODM1, Superoxide dismutase
  KO
K04564  
superoxide dismutase, Fe-Mn family [EC:1.15.1.1]
Organism
lbo  Leptolyngbya boryana
Brite
Enzymes [BR:lbo01000]
 1. Oxidoreductases
  1.15  Acting on superoxide as acceptor
   1.15.1  Acting on superoxide as acceptor (only sub-subclass identified to date)
    1.15.1.1  superoxide dismutase
     LBWT_48720
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
LinkDB All DBs
Position
complement(5133683..5134429)
Genome map
AA seq 248 aa AA seqDB search
MQTTFRRILILFVGLLVPLFFACQSNSQVDAAPSAAPQLSASPAKLDPLPYDYAALEPYI
DAQTMRLHHDKHHATYVNNINETLKAYPDLQKQSVDSLIQNLNQVPEAIRTKIRNNGGGH
VNHTMFWQIMAPKAGGTPTGAVAKAIDQTFGSFDAFKQQFNKAGADRFGSGWAWLVSDRQ
GKLSITSTANQDNPLMSNPNAYPILGNDVWEHAYYLKYQNRRAEYLTNWWNVVNWQAVNQ
RYAQAQRK
NT seq 747 nt NT seq  +upstreamnt  +downstreamnt
atgcaaacaactttcagacgtatcctcattcttttcgtcggtttgctagttccattattt
tttgcctgtcagtctaatagccaagtcgatgcggctccctcagcagcaccacagttgagt
gcttcccccgcaaagcttgatccattgccttacgattatgctgccctagagccttacatt
gatgctcaaacgatgcgacttcaccacgataagcatcatgcaacttatgtgaataacatt
aatgagactctaaaggcttatccagaccttcagaagcagagcgttgatagtttaattcag
aatctcaaccaggttccggaggcaattcggacgaagattcgcaacaacggcggcggacat
gtcaatcacacgatgttctggcagattatggctccaaaagctggaggcacgccgactgga
gctgtcgcaaaagcaattgatcagaccttcggcagttttgatgcatttaagcagcagttt
aataaagctggagccgatcgctttggcagtggatgggcgtggctcgtcagcgatcgccaa
ggaaaactcagcatcacttcaaccgcaaatcaagataatcccctgatgagcaatcccaat
gcctatccgattttaggcaatgatgtttgggaacacgcttactacctgaagtatcagaat
cgtcgagcagaatatctgacaaattggtggaatgtcgtgaactggcaagcagtcaatcaa
cgctacgcgcaagcgcagagaaagtaa

DBGET integrated database retrieval system