KEGG   Nitrosospira lacus: EBAPG3_000295Help
Entry
EBAPG3_000295     CDS       T04907                                 

Definition
(GenBank) acyl-phosphate glycerol 3-phosphate acyltransferase
Organism
nlc  Nitrosospira lacus
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
complement(72664..75534)
Genome map
AA seq 956 aa AA seqDB search
MIGERPTGQAVSAEDAAGVLLETARQLAAELHRRSSGEISATLDNSLEQDLGFDSLARVE
LLARIERVFGISLPEQVLANAETPRDLLRAVLTAAPAAAALKGIQRSEAPLQVSAEPADA
LTLPGVLDWHVRAHPHRTHITLLDEAGREDVISYVALQQGAMKIAAGLVEFGLQPGQSVA
IMLPTSHDYFCCFFGTLLAGGVPVPIYPPVRVSQIEDHLRRHAGILSNALATILITVPEA
KPVARLLRAQVETLRAITTAAELSVSGQAAEYPVQADNIALLQYTSGSTANPKGVALTHA
NLLTNIRAMGQAAGVTSTDVFVSWLPLYHDMGLIGAWLGSLYYACPLVVMSPITFLARPE
RWLWAIHQHRGTLSASPNFGYELCLHKIPDDVIDGLDLSSWRMAFNGAEPVSPATVVNFT
QRFARYGLRPEAMAPVYGLAECSVGLAFPPPGRGPLIDCIKREEFTRSGRADPAGGENAE
VLRFVACGRPLPGHQIKIVDATGNEVGERVEGYLKFKGPSATSGYFRNPEQNRLLFREGW
LDSGDFAYLAAGDIYLTGRAKDIIIRAGRNIHPHELEEAVGNISGIRKGCVAVFGSPDPA
SGTERLVVLAEMRDIDSGKQEELRGQINALTLDMLGMPADDIVLAPVHSVLKTSSGKIRR
AACRELYEKGAPPPRPVWWQVVRLAWAGALPQLRRGSRVASGILYAAYVWVLFCLLAPVT
WLATALLPRPAWGWALSRGSARLLARLSGTPLVVRGLENLPCKAPFVLVANHASYLDGIM
LVAALPGGFHAKEHFSFVAKRELLDSIVSRVYLRHIGSNFVDRFDPERGVEELKQVSRSL
RSGSRPIFFPEGTFTRMPGLLPFRMGAFMVAAEAGVPIVPVTIRGTRSILRAGHWLPRRG
IITITISKPILPDTKDWAAAIHLRDSARAEILRLCGEPDLMRGTLQEQDAQPGEEI
NT seq 2871 nt NT seq  +upstreamnt  +downstreamnt
ttgattggagagcggccaacaggacaggcggtaagcgcggaagatgcggctggcgttctg
ctggaaaccgcgcggcagctggcagctgaattgcatcgacgctccagtggggaaatttcg
gcaacgctggacaactctctggagcaggatctgggttttgacagtctcgcgagggtagaa
ctgctcgctcgcattgagcgtgtcttcgggatcagtctacccgaacaggtgctggccaat
gccgagacaccacgcgatctgttgcgagcggtattgacggccgcgcccgccgcggcagcg
ctgaagggaatacagcgaagtgaagctccacttcaggtatcggcggaaccagccgatgcg
ctgacgctgccaggagttcttgattggcacgtgcgcgcccatccgcaccgcacgcatatc
acgttgctggatgaagcgggcagggaagacgtcatctcctacgtcgcattgcagcaaggc
gccatgaaaatagcggcgggactggtggaattcgggttgcagcccggacagtccgtggcg
atcatgctgccgaccagccatgactacttctgctgcttctttgggacactgctcgcgggc
ggggttcctgtgccaatttatccccccgttcgcgtctcacagatcgaggatcatctgcgc
cggcatgcgggcattctgtccaatgcgctcgccacgatcctgattacggtgcccgaggcg
aaaccggtggctcgactgctccgggctcaggtggagacactgcgcgcaattacgactgcg
gcggagttgtccgtttccggacaggcggcggagtatcccgtccaggccgataatatcgcg
ctgttgcagtacacctccgggagtaccgccaatccgaagggcgttgccttgactcatgcc
aatttactcaccaatatccgcgcgatgggacaggcggcgggggtcacttccacggacgtg
tttgtcagctggctgccgctctatcatgacatgggcttgatcggggcctggctgggcagc
ctgtactacgcgtgtccgctggtggtgatgtcacccatcacctttctggcgcggccggaa
cgctggctgtgggcgatccatcagcaccgcggcaccctttcggcatctcccaactttggc
tatgagttgtgcctgcacaagatcccggacgatgttatcgatggattggatctgtcgagc
tggcgtatggcttttaacggtgccgagccggtgagtcccgcgactgtcgtcaatttcacg
cagcgctttgcccgctacgggctgcggccggaagcgatggcgccggtatacgggttggca
gaatgctcggttgggctcgcctttccgccgccgggccgcgggccgttgatcgactgtatc
aagcgggaagaattcacacgttccggtcgggcggatccagcgggaggcgaaaatgcggag
gtattgcgctttgtggcctgtggccggccgcttccgggccaccaaatcaaaattgttgat
gccacaggcaatgaagtgggggagcgggtggaaggatacctgaaattcaaaggaccgtcc
gctaccagtggttacttccgcaacccggagcagaatcgcctgttgtttcgcgaagggtgg
ctggattccggcgattttgcttaccttgctgcaggtgatatttatctgaccggacgtgca
aaggacattatcattcgtgccgggcgcaatatccacccccatgagctggaagaggcggtc
ggtaatatctccggcattcgtaaggggtgcgtcgcggtttttggcagcccggacccggct
tccggtacagagcgactggtggtgctggccgagatgcgcgatatcgattccggaaagcag
gaggagttgcgcggtcagatcaacgccctgactctggatatgctgggaatgccggcagac
gatattgtgctggcgcctgtccatagcgtgctcaaaacctcgagcggcaagatccgccgg
gcagcctgccgtgagttgtatgaaaagggggcgccccccccgcgcccggtatggtggcag
gtggtgcggctggcgtgggccggtgcgctgcctcagttgcgccgcggcagcagggtggca
tccggcattttatatgctgcatatgtatgggtcctgttctgcctgctggcacccgtgacc
tggctggcaaccgcattgctaccccgccccgcctgggggtgggcattaagcaggggaagc
gcacgcctccttgcacgtttgtcgggaacgccattagtggttcgcgggttggaaaatctg
ccctgcaaggcgccgtttgtgctggtggcaaaccatgccagctatctcgacggaatcatg
ctggtagcagccctgccgggcggattccatgccaaggagcatttcagttttgtagccaaa
cgggagctgctggacagtattgtttcgcgcgtatatctacggcatatcgggtcgaatttc
gtcgatcgcttcgatccggaacgcggtgtggaggaattaaagcaggtgtcccgctcattg
cggtctggtagccgtccgatattttttcccgagggcacattcacccgcatgcccggcttg
ctgcctttccggatgggtgcatttatggtggctgccgaagcgggagtgccgatagtgccc
gtaaccattcgtggtactcgctccatccttcgcgccggacattggttgcctcgccgcggg
attattaccatcacgatcagcaagcctatcttgccggataccaaggattgggctgccgcc
attcatttgagggactccgctcgtgcggaaatcttgcggctttgcggagaacctgatctc
atgaggggaacactgcaagagcaggatgctcaacccggggaggaaatttag

DBGET integrated database retrieval system