KEGG   Nitrosospira lacus: EBAPG3_002960Help
Entry
EBAPG3_002960     CDS       T04907                                 

Definition
(GenBank) phosphoenolpyruvate carboxylase
  KO
K01595  
phosphoenolpyruvate carboxylase [EC:4.1.1.31]
Organism
nlc  Nitrosospira lacus
Pathway
Pyruvate metabolism
Methane metabolism
Metabolic pathways
Microbial metabolism in diverse environments
Carbon metabolism
Module
CAM (Crassulacean acid metabolism), dark
Brite
KEGG Orthology (KO) [BR:nlc00001]
 Metabolism
  Carbohydrate metabolism
   00620 Pyruvate metabolism
    EBAPG3_002960
  Energy metabolism
   00680 Methane metabolism
    EBAPG3_002960
Enzymes [BR:nlc01000]
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.1  Carboxy-lyases
    4.1.1.31  phosphoenolpyruvate carboxylase
     EBAPG3_002960
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
complement(643945..646758)
Genome map
AA seq 937 aa AA seqDB search
MNSFATQNGGIDTNHTDEKDRPVKDDPLREDIRLLGRMLGDTLREQEGEPTFDLVENIRQ
TAIRFRREQDPKARQELDMILNQLSNKATVAVVRAFSHFSQLSNIAEDMHHNRRRRTHLR
AGSPPQAGSVALALDRVFSSGTDGAALTGFFAKALVSPVLTAHPTEVQRRSILDCQLTIA
HLLNERDRIQLTPDELRSNEEGLRSAIQILWQTRMLRPERLSVYDEIKNGLAYYRYTFLT
EVPRLYAEIEDLLERRMGADAPHIPPFLRIGSWIGSDRDGNPFVTHEVMLHAAERQSALA
LDYYMGEVHLIGRRLSLTERLVGVDDELAALSETSPDRAPSRIDEPYRRALIGIYARLAA
TSQELGHVIRQRRPVGPAAPYAEGTDFVHDLEIVIHSLKQHKSDLLARGDLRHLRRAAEV
FGFHLAPLDMRQHSNVHEQVVAELFEYGAHQRGYSELTEAERIRWLLSEITSPRPLRSPY
LDYSELIQSELCILQAAAEIQRRFGRAALPNYIISKTDGISDILEVALLLKEVGLLQAGE
IPHLHVNIIPLFETIADLRECSRVMDDLFSLPYYRKLLDSRGNVQEVMLGYSDSNKDGGF
LTANWELYKAETELTKVFAKHKVELRLFHGRGGTVGRGGGPSYQAILAQPPGSVNGQIRI
TEQGEVIGSKYADPEIGRRNLETLVAATVEATLLSHDPLGERAAEYYLIMEVLARDAFAA
YRNLVYETPGFKRYFQESTPIREIAGLNIGSRPPSRKQSDLIEDLRAIPWVFSWSVNRAM
IPGWYGFGTAVEAFVRREGQGEKGLELLQEMHRTWPFMQTLLSNMDMVLAKTDMGIASRY
AELVSDIGLREEIFGRIQAEWDRSVKWLFAVTGRTELLQDNPTLARSIRNRTPYIDPLNH
LQVELLRRYRSGDAADTVKRAIQLTINGVAAGLRNSG
NT seq 2814 nt NT seq  +upstreamnt  +downstreamnt
atgaattcatttgctacgcagaatggaggtatcgatacaaatcataccgatgaaaaagac
aggccggtaaaggatgatcccttgcgtgaggacatccgcctgctgggacgcatgctgggc
gacacattgcgcgagcaggagggtgagcccactttcgatctggtcgaaaatatccgccaa
accgcgattcgctttcgccgcgaacaggatcccaaggcgcggcaggagctggatatgata
ctcaatcagttgagtaacaaggccactgtggcggtcgtgcgcgcattcagccacttctct
cagctttcaaacattgccgaggacatgcatcacaatcgtcgacgccgtactcatcttcga
gcagggtcgcccccccaggcgggtagcgtggcgctggcgcttgatcgagtcttctccagt
ggaaccgatggtgcggccttaaccggattcttcgccaaagcgttggtttcaccggttttg
accgcccatcccacagaagtacagcgcagaagcatacttgattgtcagttgaccattgcg
catctgttgaatgagcgtgatcgcattcagctaacacccgacgaattacgcagcaacgaa
gaggggttgcgctccgccattcagatattatggcaaactcgcatgctgcgtccggaacgt
ctttcagtgtatgacgaaatcaagaatggcctggcctattaccgatatacttttcttacc
gaggtaccgcgtctttacgcggaaattgaggatttgctcgaacgccgaatgggcgcggat
gcaccacacattccaccgttcttacgcatcggcagctggataggaagcgaccgcgacggc
aatcccttcgttacccatgaggtaatgctgcacgcggctgaacgtcaatcggcgctggcg
ttggattattacatgggcgaagtgcacctgatcggccgccggctgagcctcacagagcgc
ctggtaggcgtggatgacgagcttgcggcattatccgagacatctccggaccgcgctccc
agccgcatcgatgagccctatcggcgcgccttaatcggtatttatgcgcgtcttgccgct
accagtcaggaactcggtcacgtcattaggcaaaggcggcccgtcggccccgccgcgcct
tacgcggaaggcactgattttgttcatgatctggagattgtcattcactccctgaagcag
cacaaatcagacttgctggcgcgcggggatttacgtcatctgcgacgggctgcagaggtc
ttcggctttcatctcgcaccgctggacatgcgccagcacagcaatgtgcatgagcaggta
gtggcggaattgttcgagtacggggcacatcaaagaggctattccgagctgacagaggcg
gaacgcatacggtggctgctgagcgagatcaccagtcctcgccccctgcgttcgccttat
ctggattattccgagctcatccagagcgaactatgcatactgcaagcggcagcggaaatt
caacggcgcttcggccgtgccgcgctgccaaattatattatttccaaaactgacggcatt
tccgacatactcgaggttgcattgctgttgaaggaggtggggctgttgcaagccggggaa
atcccccatcttcatgtcaatatcattcctttgttcgagaccatcgcggacttgcgcgag
tgcagccgtgtcatggacgatttgttctcgctgccctattatcgcaagctcttggattca
cgcggcaacgttcaggaagtcatgctgggttattccgatagcaacaaggatggtggcttt
cttactgccaattgggagctctacaaagccgaaaccgagctgaccaaggtatttgccaag
cataaggttgaattgcgcctttttcatgggcgcggcggcaccgtcggacgtggcgggggt
ccgagctaccaggcgatactggctcagcccccgggtagcgtcaatggtcagatacgcatc
accgagcagggtgaggtcatcggcagcaaatatgccgacccggaaatcgggcggcgcaat
ctcgaaacgttagtcgccgccacggtcgaggccacgttgttaagccacgacccccttggt
gagcgcgccgccgaatattacctgatcatggaggttctggcccgcgatgcgttcgcggct
tatcgcaatctggtctatgagaccccgggctttaaacgttactttcaagagtccacgccg
ataagggagatcgctggactcaatatcggcagccgcccgccatcacgcaagcaatccgat
cttatagaagatttacgcgccattccctgggttttcagctggagtgtcaatcgtgcgatg
attcccggctggtacggctttggtacggccgtggaagcatttgtccggcgcgaaggccaa
ggtgaaaaaggacttgaacttctacaggaaatgcaccgcacctggcctttcatgcaaaca
ctgctttccaacatggacatggtgctggcaaaaacggatatgggtatcgcctcacgttac
gctgaactggttagcgatatcgggctacgtgaggaaattttcggtcgcatccaggcggag
tgggatcgcagcgtaaaatggttattcgcggtaacgggccgcacagagctgctgcaggac
aatcctacgctggctcgcagcattcgtaaccgcaccccctatattgatccgctcaatcat
ttgcaggtagaactgttacgccgttatcgctcgggtgatgccgccgataccgtaaagcgc
gccatacagcttaccattaacggtgtggctgccgggttgagaaacagcggataa

DBGET integrated database retrieval system