Pan paniscus (bonobo): 100988840 Help Entry 100988840         CDS       T02283                                  Name (RefSeq) metallothionein-1H   KO K14739   metallothionein 1/2 Organism pps  Pan paniscus (bonobo) Pathway pps04978   Mineral absorption Brite KEGG Orthology (KO) [BR:pps00001]  09150 Organismal Systems   09154 Digestive system    04978 Mineral absorption     100988840  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:pps03019]     100988840    03029 Mitochondrial biogenesis [BR:pps03029]     100988840 Messenger RNA biogenesis [BR:pps03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      100988840 Mitochondrial biogenesis [BR:pps03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     100988840 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  100988840 NCBI-ProteinID:  XP_008975687 Ensembl:  ENSPPAG00000034882 UniProt:  A0A2R9B807 LinkDB All DBs Position 16:36947206..36948572 Genome browser AA seq 61 aa AA seqDB search MDPNCSCEAGGSCACAGSCKCKKCKCTSCKKSCCSCCPLGCAKCAQSCICKGASEKCSCC A NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggaccccaactgctcctgcgaggctggtggctcctgtgcctgcgccggctcctgcaag tgcaaaaagtgcaaatgcacctcctgcaagaagagctgctgctcctgttgccccctgggc tgtgccaagtgtgcccagagctgcatctgcaaaggggcgtcagagaagtgcagctgctgt gcctga

DBGET integrated database retrieval system