KEGG   Pseudorhodoplanes sinuspersici: CAK95_21225Help
Entry
CAK95_21225       CDS       T04834                                 

Definition
(GenBank) elongation factor Tu
  KO
K02358  
elongation factor Tu
Organism
psin  Pseudorhodoplanes sinuspersici
Brite
Translation factors [BR:psin03012]
 Eukaryotic Type
  Elongation factors
   CAK95_21225
 Prokaryotic Type
   CAK95_21225
Mitochondrial biogenesis [BR:psin03029]
 Mitochondrial DNA transcription, translation, and replication factors
  Mitochondrial transcription and translation factors
   Mitochondrial translation factors
    CAK95_21225
Exosome [BR:psin04147]
 Exosomal proteins
  Exosomal proteins of haemopoietic cells  (B-cell, T-cell, DC-cell, reticulocyte, and mast cell)
   CAK95_21225
  Exosomal proteins of breast cancer cells
   CAK95_21225
  Exosomal proteins of colorectal cancer cells
   CAK95_21225
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
LinkDB All DBs
Position
4388294..4389484
Genome map
AA seq 396 aa AA seqDB search
MAKEKFNRSKPHCNIGTIGHVDHGKTSLTAAITKVLAESGGASFTAYDQIDKAPEEKARG
ITISTAHVEYETPNRHYAHVDCPGHADYVKNMITGAAQMDGAILVVSAADGPMPQTREHI
LLARQVGVPALVVFLNKVDMVDDPELLELVELEVRELLSKYNFPGDTIPIIKGSALCALE
DKDPKLGHDAVLELMKAVDDYIPQPERPIDQPFLMPVEDVFSISGRGTVCTGRVERGIVK
VGEEVEIVGLKPTLKTTVTGVEMFRKLLDQGQAGDNIGALLRGTKREEVERGQVLCKPGS
VKPHTKFKAEAYILTKEEGGRHTPFFTNYRPQFYFRTTDVTGIVHLPEGTEMVMPGDNIA
MEVHLIVPIAMEEKLRFAIREGGRTVGAGVVASIIE
NT seq 1191 nt NT seq  +upstreamnt  +downstreamnt
atggctaaagagaaattcaaccgcagcaagccgcactgcaatatcggcaccatcggtcac
gtcgaccatggcaagacgtcgttgacggctgcgatcacgaaggttctggcggagtcgggc
ggtgcgtccttcacggcctatgaccagatcgacaaggcgccggaagagaaggcgcgcggc
atcaccatctcgaccgctcacgtcgagtatgagacgccgaaccgtcactatgcgcacgtc
gactgccctggccacgccgactacgtgaagaacatgatcaccggtgcggcgcagatggac
ggcgcgatcctcgtcgtgtcggctgctgacggcccgatgccgcagacccgcgagcacatc
ctgctcgcccgccaggtcggcgtgccggcgctcgtcgtgttcctgaacaaggtcgacatg
gtcgacgatccggagctgctcgagctcgtcgaactcgaagtgcgcgagcttctctccaag
tacaatttcccgggcgacacgatcccgatcatcaagggctcggctctctgcgctctcgaa
gacaaggatccgaagctcggccatgacgctgtgcttgagctgatgaaggcggtggacgat
tacattccgcagccggagcgtccgatcgatcagccgttcctgatgccggttgaagacgtg
ttctcgatctcgggccgcggcactgtgtgcaccggtcgcgtcgagcgcggcatcgtgaag
gtcggtgaggaagtcgagatcgtcggtctgaagccgacgctgaagacgactgttaccggc
gttgaaatgttccgcaagctgctcgatcagggccaggcgggcgacaacatcggcgcgctg
ctgcgcggcaccaagcgcgaggaagtcgagcgcggccaggtgctctgcaagccgggctcg
gtgaagccgcacacgaagttcaaggccgaagcctacatcctcaccaaggaagagggtggc
cgccacacgccgttcttcaccaactaccgtccgcaattctatttccgcacgaccgacgtg
accggcatcgtgcatctgccggaaggcacggaaatggtgatgccgggcgacaacatcgcg
atggaagtgcacctgatcgtgccgatcgcgatggaagagaagctccgcttcgctatccgc
gaaggtggccgcaccgtcggcgccggcgtggttgcaagcatcatcgagtaa

DBGET integrated database retrieval system