Nakamurella antarctica: EH165_01340 Help Entry EH165_01340       CDS       T05729                                  Name (GenBank) mycoredoxin   KO K18917   mycoredoxin [EC:1.20.4.3] Organism nak  Nakamurella antarctica Brite KEGG Orthology (KO) [BR:nak00001]  09190 Not Included in Pathway or Brite   09191 Unclassified: metabolism    99980 Enzymes with EC numbers     EH165_01340 Enzymes [BR:nak01000]  1. Oxidoreductases   1.20  Acting on phosphorus or arsenic in donors    1.20.4  With disulfide as acceptor     1.20.4.3  mycoredoxin      EH165_01340 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Glutaredoxin GST_N_2 Thioredoxin_2 HCBP_related Glrx-like Tsi1 GST_N_3 Thioredoxin Thioredoxin_7 Thioredoxin_9 AhpC-TSA Motif Other DBs NCBI-ProteinID:  AZI57013 UniProt:  A0A3G8ZI76 LinkDB All DBs Position 300861..301100 Genome browser AA seq 79 aa AA seqDB search MSELTVYTTSWCPYCHRLAMDLDRAGIEFDDIDIEQTPDAATIVEGFNNGNRTVPTVVFA DGTAMTNPSVAQVTAKLGS NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atgagcgaactgactgtgtacacgacgtcctggtgcccctactgccaccggttagcgatg gatcttgaccgagcaggtatcgaattcgacgatatcgatatcgaacagaccccggacgcc gccaccatcgtcgagggttttaataacggaaaccggacggtaccaactgttgtgttcgcg gacggcactgcaatgacgaatccgtccgtcgcgcaagtgacggctaaacttgggagttga

DBGET integrated database retrieval system