KEGG   Aggregatibacter aphrophilus NJ8700: NT05HA_0443Help
Entry
NT05HA_0443       tRNA      T00929                                 

Definition
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
aap  Aggregatibacter aphrophilus NJ8700
Pathway
aap00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:aap00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    NT05HA_0443
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:aap03100]
    NT05HA_0443
Non-coding RNAs [BR:aap03100]
 Transfer RNA
  NT05HA_0443
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
453075..453150
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
ggggatatagctcagctgggagagcgcctgccttgcacgcaggaggtcagcggttcgatc
ccgcttatctccacca

DBGET integrated database retrieval system