KEGG   Aeromonas caviae: VI35_06045Help
Entry
VI35_06045        gene      T05190                                 

Definition
(GenBank) pseudogene
Organism
acav  Aeromonas caviae
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
1253024..1254976
Genome map
NT seq 1953 nt NT seq  +upstreamnt  +downstreamnt
atgatcccggaattagggcagttctcactgatcctggccttcgccaccgccctgctgctg
ggcagttacccgctgatcggggcccatctcggtcgtcttggcatgatgtcggcggcccgc
ccgctcgcctacagccagttcctgctgctgctgctgtcgtttctctgcctcacctgggcc
tttatcgacaacgacttcaccgtgcagtacgtggccaccaactccaacagcctgctgccc
ctgcaataccgcatctcggcggtgtggggagcccatgaaggctcgctgctgctctgggtg
ctgaccctggggggctggacggcggcggtggccctcttcagtcgccgcctgccgctcgat
gcggtggcgcgggtactcggggtgctcggccttatctcggtgggcttcaccgccttcgtg
ctgttcacctcggatcctttcacccgcaccctgccgtatttcccggtggacgggcgggat
ctcaatccgctgctgcaggatcccggtctcatcttccaccccccatgctctacatgggct
acgtgggcttctcggtggccttcgccttcgccatcgcctccctgatgacggggcgtctgg
acgccacctgggcgcgctggtcccgtccctggaccatggcggcctgggtcttcctgacgc
tgggcatcgtgctcggttcctggtgggcctattacgaactcggctggggcggctggtggt
tctgggacccggtggaaaacgcctccttcatgccctggctggcgggcacggccctgctcc
actccctcgcggtgagcgagaagcgcgccaccttcaaggcctggaccgtgctgctggcgc
tctcggccttctccctgagcctgctcggcaccttcctggtgcgttccggcgtgctggtat
cggtccatgcgtttgcctcggacccgacccggggtctgtttatcctgggcttcctgctgg
cggtgataggcagctccctgctgctgttcgccttcaagggctcccaggtgaagagccacg
gcaagcatgagctgtggagccgcgagaccctgctccttggcaacaacatcctgctggtgg
cgggtctgctcaccgtgctgctcggcaccctgttgcccctggtgcacaaggagctggggc
ttggcagcatctccatcggcacccccttcttcaaccacatctacagctggctcatcatcc
ccttcgccctgctgctggggtgggccccctgttccgctggcgccgccaggatctcggtga
gctcaagggcaaggtgatgctcgccctggtgctgagcctggccgcggctctgctgttgcc
caaactctttgccgaggcgttcaaaccctgggctgcgctcggtatcggccttggcgtctg
gatcatcgtcaccagtgtgcaggagacctgggcgcgggccacccacaaacacggttttgc
caccggcgtgcgcaagcttggcaacagccactgggccatgatcctggggcacgtggggct
cgcggtcagcatcatcggcatcgcctgcacccagaactacagcatcgagaaggacctgcg
gatgcaggccggcgatcgcgtccagttcgccgattacgagttcgtcttcaccggcatcaa
ggagaagaacggccccaactacgacggtttcaagggcgtgctggaagtgcaccgggatgg
caagcaggtagccctgctcaaacccgagaagcggatgtacaccgtgagccgcatgccgat
gaccgaggcggccatcgatgcgggtgttacccgggatctctatgcggcgctcggcgagca
gctcgacaacggcgcctgggcggtacggatctactacaagcccttcgtgcgctggatctg
ttcggcggcgtcttcatggccctcggcggcgtgctggccatgctggacaagcgctaccgc
ttcggacgtcgtgacgaggaggccaaggcatga

DBGET integrated database retrieval system