KEGG   Acinetobacter oleivorans: AOLE_t19548Help
Entry
AOLE_t19548       tRNA      T01263                                 

Definition
(GenBank) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
acd  Acinetobacter oleivorans
Pathway
acd00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:acd00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    AOLE_t19548
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:acd03100]
    AOLE_t19548
Non-coding RNAs [BR:acd03100]
 Transfer RNA
  AOLE_t19548
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
LinkDB All DBs
Position
complement(1162159..1162234)
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
tctcccatagctcagtcggtagagcgacggactgttaatccgcaggtccctggttcgagc
ccaggtgggagagcca

DBGET integrated database retrieval system