KEGG   Achromobacter sp. AONIH1: C2U31_20045Help
Entry
C2U31_20045       CDS       T05288                                 

Definition
(GenBank) pyruvate dehydrogenase
  KO
K00163  pyruvate dehydrogenase E1 component [EC:1.2.4.1]
Organism
achr  Achromobacter sp. AONIH1
Pathway
achr00010  Glycolysis / Gluconeogenesis
achr00020  Citrate cycle (TCA cycle)
achr00620  Pyruvate metabolism
achr01100  Metabolic pathways
achr01110  Biosynthesis of secondary metabolites
achr01120  Microbial metabolism in diverse environments
achr01130  Biosynthesis of antibiotics
achr01200  Carbon metabolism
Module
achr_M00307  Pyruvate oxidation, pyruvate => acetyl-CoA
Brite
KEGG Orthology (KO) [BR:achr00001]
 09100 Metabolism
  09101 Carbohydrate metabolism
   00010 Glycolysis / Gluconeogenesis
    C2U31_20045
   00020 Citrate cycle (TCA cycle)
    C2U31_20045
   00620 Pyruvate metabolism
    C2U31_20045
Enzymes [BR:achr01000]
 1. Oxidoreductases
  1.2  Acting on the aldehyde or oxo group of donors
   1.2.4  With a disulfide as acceptor
    1.2.4.1  pyruvate dehydrogenase (acetyl-transferring)
     C2U31_20045
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AUT48087
UniProt: A0A2I8DL81
LinkDB All DBs
Position
complement(4368881..4369918)
Genome map
AA seq 345 aa AA seqDB search
MSSHTHNGPRPSASTRAAAQACLARMAARRSGAAHQARESPAAMARGLARTLLAEAGDAS
HLSLVKGPGADDVPDAGLAAAWPLRFGGAEPGHEKPLLYFLRASAASALRAACWETQDRG
IILNLAETTPSRWTKGVMPDVPVWLNAYLPCTPYDPASADEARAILRGALQALYVDGDAG
CCYLTLHGDDAGADPLSEPDAQAAWRGMYRIGPASADARIRLCGAGKALSRVIQAAGWLR
RDWGIDSEIWSCPSYTRLARDAGAADRWNGLNPLMTPRTSHLDACLNGDARPVLAVTDYH
QPIAGQIGAHVRAPFVAVGADSQAREHARPADAQWLVAMALRMLG
NT seq 1038 nt NT seq  +upstreamnt  +downstreamnt
atgtccagccacacgcacaatgggccccgaccttcggccagcacccgcgccgccgcacag
gcgtgcctggcgcgcatggccgcccgccgttccggcgcggcgcatcaagcacgggagtcg
ccggccgcgatggctcggggactggcgcgcacgctgctcgcggaagccggggacgccagc
cacctgtcgctggtcaagggccccggcgcggacgatgtgcccgacgcgggcctcgcggcg
gcctggccgctgcgcttcggcggcgcggagccaggccatgaaaaaccgctgctgtatttt
ttgcgcgccagcgccgccagcgcgctgcgcgcggcctgctgggaaacgcaggatcgcggc
atcatcctgaacctggcggaaaccacgccgtcgcgctggaccaagggcgtgatgcccgat
gtgccggtctggctcaatgcctacctgccctgcacgccgtatgacccggcatcggccgac
gaggcccgcgcgatcctgcggggcgcgctgcaagccctgtatgtggatggtgacgccggc
tgctgctacctgacgctgcatggcgatgacgcgggcgcggatccgctcagcgagccggac
gcgcaagccgcttggcgcgggatgtaccgcatcggcccggcgtcggccgacgcgcggatc
cggctgtgcggcgcgggcaaggccttgtcgcgcgtgatccaggcggccgggtggctgcgc
cgtgactggggcatagacagcgagatctggagctgccccagctatacgcgcctggcgcgc
gacgccggcgccgccgaccgctggaacgggctcaaccccctgatgacgccccggacctcg
catctggacgcctgcctgaacggcgatgcgcgccccgtgctcgcggtcacggactaccac
cagcccatcgccggccagatcggcgcccatgtgcgggcgcctttcgtggcggtgggcgcc
gactcgcaggcccgcgagcatgccaggcccgccgacgcgcagtggctcgtcgccatggcg
ctgcggatgctgggctga

DBGET integrated database retrieval system